Human AIMP1/EMAP2/EMAPII ORF/cDNA clone-Lentivirus plasmid (NM_001142416)
Cat. No.: pGMLP002984
Size: 10 µg
Concentration: generally 0.5ug/ul, usually not less than 0.3ug/ul
Leading Time: 3-7 working days
Pre-made Human AIMP1/EMAP2/EMAPII Lentiviral expression plasmid for AIMP1 lentivirus packaging, AIMP1 lentivirus production, overexpression stable cell line development, cell transient transfection and gene delivery targeting T/B/NK cells, macrophages, cardiomyocytes, hepatocytes, and neurons.
Our GM-Lentiviral vector is seamlessly integrated with the GM lentivirus packaging system. Discover more about the GM lentivirus packaging system.
Go to
AIMP1/EMAP2 products
collection>>
(antibodies,
antigen, VLP, mRNA, ORF viral vector, etc)
Product Description
Catalog ID | pGMLP002984 |
Gene Name | AIMP1 |
Accession Number | NM_001142416 |
Gene ID | 9255 |
Species | Human |
Product Type | Lentivirus plasmid (overexpression) |
Insert Length | 1011 bp |
Gene Alias | EMAP2,EMAPII,HLD3,p43,SCYE1 |
Fluorescent Reporter | ZsGreen |
Mammalian Cell Selection | Puromyocin |
Fusion Tag | 3xflag (C-Terminal) |
Promoter | CMV |
Resistance | Amplicin |
ORF Nucleotide Sequence | ATGGCAAATAATGATGCTGTTCTGAAGAGACTGGAGCAGAAGGGTGCAGAGGCAGATCAAATCATTGAATATCTTAAGCAGCAAGTTTCTCTACTTAAGGAGAAAGCAATTTTGCAGGCAACTTTGAGGGAAGAGAAGAAACTTCGAGTTGAAAATGCTAAACTGAAGAAAGAAATTGAAGAACTGAAACAAGAGCTAATTCAGGCAGAAATTCAAAATGGAGTGAAGCAAATACCATTTCCATCTGGTACTCCACTGCACGCTAATTCTATGGTTTCTGAAAATGTGATACAGTCTACAGCAGTAACAACCGTATCTTCTGGTACCAAAGAACAGATAAAAGGAGGAACAGGAGACGAAAAGAAAGCGAAAGAGAAAATTGAAAAGAAAGGAGAGAAGAAGGAGAAAAAACAGCAATCAATAGCTGGAAGTGCCGACTCTAAGCCAATAGATGTTTCCCGTCTGGATCTTCGAATTGGTTGCATCATAACTGCTAGAAAACACCCTGATGCAGATTCTTTGTATGTGGAAGAAGTAGATGTCGGAGAAATAGCCCCAAGGACAGTTGTCAGTGGCCTGGTGAATCATGTTCCTCTTGAACAGATGCAAAATCGGATGGTGATTTTACTTTGTAACCTGAAACCTGCAAAGATGAGGGGAGTATTATCTCAAGCAATGGTCATGTGTGCTAGTTCACCAGAGAAAATTGAAATCTTGGCTCCTCCAAATGGGTCTGTTCCTGGAGACAGAATTACTTTTGATGCTTTCCCAGGAGAGCCTGACAAGGAGCTGAATCCTAAGAAGAAGATTTGGGAGCAGATCCAGCCTGATCTTCACACTAATGATGAGTGTGTGGCTACATACAAAGGAGTTCCCTTTGAGGTGAAAGGGAAGGGAGTATGTAGGGCTCAAACCATGAGCAACAGTGGAATCAAATAA |
ORF Protein Sequence | MANNDAVLKRLEQKGAEADQIIEYLKQQVSLLKEKAILQATLREEKKLRVENAKLKKEIEELKQELIQAEIQNGVKQIPFPSGTPLHANSMVSENVIQSTAVTTVSSGTKEQIKGGTGDEKKAKEKIEKKGEKKEKKQQSIAGSADSKPIDVSRLDLRIGCIITARKHPDADSLYVEEVDVGEIAPRTVVSGLVNHVPLEQMQNRMVILLCNLKPAKMRGVLSQAMVMCASSPEKIEILAPPNGSVPGDRITFDAFPGEPDKELNPKKKIWEQIQPDLHTNDECVATYKGVPFEVKGKGVCRAQTMSNSGIK |
Reference
Data / case study
Click to get more Data / Case study about the product.
Associated products
Category | Cat No. | Products Name |
---|---|---|
Target Antibody | GM-Tg-g-SE0657-Ab | Anti-AIMP1/ EMAP2/ EMAPII functional antibody |
Target Antigen | GM-Tg-g-SE0657-Ag | AIMP1 protein |
ORF Viral Vector | pGMLP002984 | Human AIMP1 Lentivirus plasmid |
ORF Viral Vector | vGMLP002984 | Human AIMP1 Lentivirus particle |
Target information
Target ID | GM-SE0657 |
Target Name | AIMP1 |
Gene ID | 9255, 13722, 695147, 114632, 101084875, 487893, 505126, 100073027 |
Gene Symbol and Synonyms | 9830137A06Rik,AIMP1,AIMP1/p43,EMAP2,EMAPII,HLD3,p43,SCYE1 |
Uniprot Accession | Q12904 |
Uniprot Entry Name | AIMP1_HUMAN |
Protein Sub-location | Secreted Protein/Potential Cytokines |
Category | Not Available |
Disease | Not Available |
Gene Ensembl | ENSG00000164022 |
Target Classification | Not Available |
The protein encoded by this gene is a cytokine that is specifically induced by apoptosis, and it is involved in the control of angiogenesis, inflammation, and wound healing. The release of this cytokine renders the tumor-associated vasculature sensitive to tumor necrosis factor. The precursor protein is identical to the p43 subunit, which is associated with the multi-tRNA synthetase complex, and it modulates aminoacylation activity of tRNA synthetase in normal cells. This protein is also involved in the stimulation of inflammatory responses after proteolytic cleavage in tumor cells. Multiple transcript variants encoding different isoforms have been found for this gene. A pseudogene has been identified on chromosome 20. [provided by RefSeq, Dec 2008]
About GMVC
GMVC (GM Vector Core) is GeneMedi’s unique platform for QbD Viral vectors Processes development and manufacturing. In GMVC, our core expertise lies in the tailored production of viral vectors, including adeno-associated virus (AAV), lentivirus, and adenovirus. Our state-of-the-art facilities are equipped for scalable manufacturing, ensuring high-quality viral vector production to meet both research and therapeutic needs. Our expert team specializes in process development, leveraging innovative technology and extensive industry knowledge to provide clients with tailored solutions that exceed expectations. GMVC will be the ideal partner for scientists and healthcare professionals seeking reliable and efficient viral vector production services.