Human AIMP1/EMAP2/EMAPII ORF/cDNA clone-Lentivirus particle (NM_001142416)

Cat. No.: vGMLP002984

Pre-made Human AIMP1/EMAP2/EMAPII Lentiviral expression plasmid for AIMP1 lentivirus packaging, AIMP1 lentivirus production, overexpression stable cell line development, cell transient transfection and gene delivery targeting T/B/NK cells, macrophages, cardiomyocytes, hepatocytes, and neurons.

The GM Vector Core (GMVC) specializes in custom lentivirus development and offers a range of lentivirus manufacturing solutions, leveraging state-of-the-art processes. Learn more about our services.

Target products collection

Go to AIMP1/EMAP2 products collection>>
(antibodies, antigen, VLP, mRNA, ORF viral vector, etc)

Product information

Catalog No. Product Name lentivirus Grade lentivirus quantity
vGMLP002984 Human AIMP1 Lentivirus particle Pilot Grade 1.0E+8TU
5.0E+8TU
1.0E+9TU
Research Grade 1.0E+8TU
5.0E+8TU
1.0E+9TU
GMP-like Grade inquiry
GMP Grade inquiry


Product Description

Catalog ID vGMLP002984
Gene Name AIMP1
Accession Number NM_001142416
Gene ID 9255
Species Human
Product Type Lentivirus particle (overexpression)
Insert Length 1011 bp
Gene Alias EMAP2,EMAPII,HLD3,p43,SCYE1
Fluorescent Reporter ZsGreen
Mammalian Cell Selection Puromyocin
Fusion Tag 3xflag (C-Terminal)
Promoter CMV
Resistance Amplicin
ORF Nucleotide Sequence ATGGCAAATAATGATGCTGTTCTGAAGAGACTGGAGCAGAAGGGTGCAGAGGCAGATCAAATCATTGAATATCTTAAGCAGCAAGTTTCTCTACTTAAGGAGAAAGCAATTTTGCAGGCAACTTTGAGGGAAGAGAAGAAACTTCGAGTTGAAAATGCTAAACTGAAGAAAGAAATTGAAGAACTGAAACAAGAGCTAATTCAGGCAGAAATTCAAAATGGAGTGAAGCAAATACCATTTCCATCTGGTACTCCACTGCACGCTAATTCTATGGTTTCTGAAAATGTGATACAGTCTACAGCAGTAACAACCGTATCTTCTGGTACCAAAGAACAGATAAAAGGAGGAACAGGAGACGAAAAGAAAGCGAAAGAGAAAATTGAAAAGAAAGGAGAGAAGAAGGAGAAAAAACAGCAATCAATAGCTGGAAGTGCCGACTCTAAGCCAATAGATGTTTCCCGTCTGGATCTTCGAATTGGTTGCATCATAACTGCTAGAAAACACCCTGATGCAGATTCTTTGTATGTGGAAGAAGTAGATGTCGGAGAAATAGCCCCAAGGACAGTTGTCAGTGGCCTGGTGAATCATGTTCCTCTTGAACAGATGCAAAATCGGATGGTGATTTTACTTTGTAACCTGAAACCTGCAAAGATGAGGGGAGTATTATCTCAAGCAATGGTCATGTGTGCTAGTTCACCAGAGAAAATTGAAATCTTGGCTCCTCCAAATGGGTCTGTTCCTGGAGACAGAATTACTTTTGATGCTTTCCCAGGAGAGCCTGACAAGGAGCTGAATCCTAAGAAGAAGATTTGGGAGCAGATCCAGCCTGATCTTCACACTAATGATGAGTGTGTGGCTACATACAAAGGAGTTCCCTTTGAGGTGAAAGGGAAGGGAGTATGTAGGGCTCAAACCATGAGCAACAGTGGAATCAAATAA
ORF Protein Sequence MANNDAVLKRLEQKGAEADQIIEYLKQQVSLLKEKAILQATLREEKKLRVENAKLKKEIEELKQELIQAEIQNGVKQIPFPSGTPLHANSMVSENVIQSTAVTTVSSGTKEQIKGGTGDEKKAKEKIEKKGEKKEKKQQSIAGSADSKPIDVSRLDLRIGCIITARKHPDADSLYVEEVDVGEIAPRTVVSGLVNHVPLEQMQNRMVILLCNLKPAKMRGVLSQAMVMCASSPEKIEILAPPNGSVPGDRITFDAFPGEPDKELNPKKKIWEQIQPDLHTNDECVATYKGVPFEVKGKGVCRAQTMSNSGIK

Reference




    Data / case study


    Click to get more Data / Case study about the product.



    Associated products


    Category Cat No. Products Name
    Target Antibody GM-Tg-g-SE0657-Ab Anti-AIMP1/ EMAP2/ EMAPII functional antibody
    Target Antigen GM-Tg-g-SE0657-Ag AIMP1 protein
    ORF Viral Vector pGMLP002984 Human AIMP1 Lentivirus plasmid
    ORF Viral Vector vGMLP002984 Human AIMP1 Lentivirus particle


    Target information

    Target ID GM-SE0657
    Target Name AIMP1
    Gene ID 9255, 13722, 695147, 114632, 101084875, 487893, 505126, 100073027
    Gene Symbol and Synonyms 9830137A06Rik,AIMP1,AIMP1/p43,EMAP2,EMAPII,HLD3,p43,SCYE1
    Uniprot Accession Q12904
    Uniprot Entry Name AIMP1_HUMAN
    Protein Sub-location Secreted Protein/Potential Cytokines
    Category Not Available
    Disease Not Available
    Gene Ensembl ENSG00000164022
    Target Classification Not Available

    The protein encoded by this gene is a cytokine that is specifically induced by apoptosis, and it is involved in the control of angiogenesis, inflammation, and wound healing. The release of this cytokine renders the tumor-associated vasculature sensitive to tumor necrosis factor. The precursor protein is identical to the p43 subunit, which is associated with the multi-tRNA synthetase complex, and it modulates aminoacylation activity of tRNA synthetase in normal cells. This protein is also involved in the stimulation of inflammatory responses after proteolytic cleavage in tumor cells. Multiple transcript variants encoding different isoforms have been found for this gene. A pseudogene has been identified on chromosome 20. [provided by RefSeq, Dec 2008]



    About GMVC

    GDU

    GMVC (GM Vector Core) is GeneMedi’s unique platform for QbD Viral vectors Processes development and manufacturing. In GMVC, our core expertise lies in the tailored production of viral vectors, including adeno-associated virus (AAV), lentivirus, and adenovirus. Our state-of-the-art facilities are equipped for scalable manufacturing, ensuring high-quality viral vector production to meet both research and therapeutic needs. Our expert team specializes in process development, leveraging innovative technology and extensive industry knowledge to provide clients with tailored solutions that exceed expectations. GMVC will be the ideal partner for scientists and healthcare professionals seeking reliable and efficient viral vector production services.