Human PRDX5/ACR1/ AOEB166 ORF/cDNA clone-Lentivirus plasmid (NM_012094)

Pre-made Human PRDX5/ACR1/ AOEB166 Lentiviral expression plasmid for PRDX5 lentivirus packaging, PRDX5 lentivirus production, overexpression stable cell line development, cell transient transfection and gene delivery targeting T/B/NK cells, macrophages, cardiomyocytes, hepatocytes, and neurons.

Our GM-Lentiviral vector is seamlessly integrated with the GM lentivirus packaging system. Discover more about the GM lentivirus packaging system.

Target products collectionGo to PRDX5/ACR1 products collection >>
(antibodies, antigen, VLP, mRNA, ORF viral vector, etc)



Product information

Catalog No. Product Name Plasmid Grade Plasmid quantity
pGMLP002999 Human PRDX5 Lentivirus plasmid Research Grade 10mg, 50mg, 100mg, 500mg, >1g
GMP-like Grade 10mg, 50mg, 100mg, 500mg, >1g
High Quality (HQ) Grade
Seed 5ug


Product Description

Catalog ID pGMLP002999
Gene Name PRDX5
Accession Number NM_012094
Gene ID 25824
Species Human
Product Type Lentivirus plasmid (overexpression)
Insert Length 645 bp
Gene Alias ACR1, AOEB166, B166, HEL-S-55, PLP, PMP20, PRDX6, prx-V, PRXV, SBBI10
Fluorescent Reporter ZsGreen
Mammalian Cell Selection Puromyocin
Fusion Tag 3xflag (C-Terminal)
Promoter CMV
Resistance Amplicin
Sequence ATGGGACTAGCTGGCGTGTGCGCCCTGAGACGCTCAGCGGGCTATATACTCGTCGGTGGGGCCGGCGGTCAGTCTGCGGCAGCGGCAGCAAGACGGTGCAGTGAAGGAGAGTGGGCGTCTGGCGGGGTCCGCAGTTTCAGCAGAGCCGCTGCAGCCATGGCCCCAATCAAGGTGGGAGATGCCATCCCAGCAGTGGAGGTGTTTGAAGGGGAGCCAGGGAACAAGGTGAACCTGGCAGAGCTGTTCAAGGGCAAGAAGGGTGTGCTGTTTGGAGTTCCTGGGGCCTTCACCCCTGGATGTTCCAAGACACACCTGCCAGGGTTTGTGGAGCAGGCTGAGGCTCTGAAGGCCAAGGGAGTCCAGGTGGTGGCCTGTCTGAGTGTTAATGATGCCTTTGTGACTGGCGAGTGGGGCCGAGCCCACAAGGCGGAAGGCAAGGTTCGGCTCCTGGCTGATCCCACTGGGGCCTTTGGGAAGGAGACAGACTTATTACTAGATGATTCGCTGGTGTCCATCTTTGGGAATCGACGTCTCAAGAGGTTCTCCATGGTGGTACAGGATGGCATAGTGAAGGCCCTGAATGTGGAACCAGATGGCACAGGCCTCACCTGCAGCCTGGCACCCAATATCATCTCACAGCTCTGA

Reference




    Data / case study


    Click to get more Data / Case study about the product.



    Associated products


    Category Cat No. Products Name
    Target Antibody GM-Tg-g-T77009-Ab Anti-PRDX5 monoclonal antibody
    Target Antigen GM-Tg-g-T77009-Ag PRDX5 protein
    ORF Viral Vector pGMLP002999 Human PRDX5 Lentivirus plasmid
    ORF Viral Vector vGMLP002999 Human PRDX5 Lentivirus particle


    Target information

    Target ID GM-T77009
    Target Name PRDX5
    Gene ID 25824, 54683, 719764, 113898, 101093462, 476032, 282885, 100055657
    Gene Symbol and Synonyms ACR1,AOEB166,AOPP,B166,HEL-S-55,PLP,PMP20,PRDX5,PRDX6,Prx V,prx-V,PRXV,SBBI10
    Uniprot Accession P30044
    Uniprot Entry Name PRDX5_HUMAN
    Protein Sub-location Introcelluar Protein
    Category Therapeutics Target
    Disease Not Available
    Gene Ensembl ENSG00000126432
    Target Classification Not Available

    This gene encodes a member of the peroxiredoxin family of antioxidant enzymes, which reduce hydrogen peroxide and alkyl hydroperoxides. The encoded protein interacts with peroxisome receptor 1 and plays an antioxidant protective role in different tissues under normal conditions and during inflammatory processes. The use of alternate transcription start sites is thought to result in transcript variants that use different in-frame translational start codons to generate isoforms that are targeted to the mitochondrion (isoform L) or peroxisome/cytoplasm (isoform S). Multiple related pseudogenes have been defined for this gene. [provided by RefSeq, Nov 2017]



    About GMVC

    GDU



    GMVC (GM Vector Core) is GeneMedi’s unique platform for QbD Viral vectors Processes development and manufacturing. In GMVC, our core expertise lies in the tailored production of viral vectors, including adeno-associated virus (AAV), lentivirus, and adenovirus. Our state-of-the-art facilities are equipped for scalable manufacturing, ensuring high-quality viral vector production to meet both research and therapeutic needs. Our expert team specializes in process development, leveraging innovative technology and extensive industry knowledge to provide clients with tailored solutions that exceed expectations. GMVC will be the ideal partner for scientists and healthcare professionals seeking reliable and efficient viral vector production services.