Human PRDX5/ACR1/ AOEB166 ORF/cDNA clone-Lentivirus plasmid (NM_012094)
Pre-made Human PRDX5/ACR1/ AOEB166 Lentiviral expression plasmid for PRDX5 lentivirus packaging, PRDX5 lentivirus production, overexpression stable cell line development, cell transient transfection and gene delivery targeting T/B/NK cells, macrophages, cardiomyocytes, hepatocytes, and neurons.
Our GM-Lentiviral vector is seamlessly integrated with the GM lentivirus packaging system. Discover more about the GM lentivirus packaging system.
Go
to PRDX5/ACR1 products collection
>>
(antibodies,
antigen, VLP, mRNA, ORF viral vector, etc)
Product information
Catalog No. | Product Name | Plasmid Grade | Plasmid quantity |
---|---|---|---|
pGMLP002999 | Human PRDX5 Lentivirus plasmid | Research Grade | 10mg, 50mg, 100mg, 500mg, >1g |
GMP-like Grade | 10mg, 50mg, 100mg, 500mg, >1g | ||
High Quality (HQ) Grade | |||
Seed | 5ug |
Product Description
Catalog ID | pGMLP002999 |
Gene Name | PRDX5 |
Accession Number | NM_012094 |
Gene ID | 25824 |
Species | Human |
Product Type | Lentivirus plasmid (overexpression) |
Insert Length | 645 bp |
Gene Alias | ACR1, AOEB166, B166, HEL-S-55, PLP, PMP20, PRDX6, prx-V, PRXV, SBBI10 |
Fluorescent Reporter | ZsGreen |
Mammalian Cell Selection | Puromyocin |
Fusion Tag | 3xflag (C-Terminal) |
Promoter | CMV |
Resistance | Amplicin |
Sequence | ATGGGACTAGCTGGCGTGTGCGCCCTGAGACGCTCAGCGGGCTATATACTCGTCGGTGGGGCCGGCGGTCAGTCTGCGGCAGCGGCAGCAAGACGGTGCAGTGAAGGAGAGTGGGCGTCTGGCGGGGTCCGCAGTTTCAGCAGAGCCGCTGCAGCCATGGCCCCAATCAAGGTGGGAGATGCCATCCCAGCAGTGGAGGTGTTTGAAGGGGAGCCAGGGAACAAGGTGAACCTGGCAGAGCTGTTCAAGGGCAAGAAGGGTGTGCTGTTTGGAGTTCCTGGGGCCTTCACCCCTGGATGTTCCAAGACACACCTGCCAGGGTTTGTGGAGCAGGCTGAGGCTCTGAAGGCCAAGGGAGTCCAGGTGGTGGCCTGTCTGAGTGTTAATGATGCCTTTGTGACTGGCGAGTGGGGCCGAGCCCACAAGGCGGAAGGCAAGGTTCGGCTCCTGGCTGATCCCACTGGGGCCTTTGGGAAGGAGACAGACTTATTACTAGATGATTCGCTGGTGTCCATCTTTGGGAATCGACGTCTCAAGAGGTTCTCCATGGTGGTACAGGATGGCATAGTGAAGGCCCTGAATGTGGAACCAGATGGCACAGGCCTCACCTGCAGCCTGGCACCCAATATCATCTCACAGCTCTGA |
Reference
Data / case study
Click to get more Data / Case study about the product.
Associated products
Category | Cat No. | Products Name |
---|---|---|
Target Antibody | GM-Tg-g-T77009-Ab | Anti-PRDX5 monoclonal antibody |
Target Antigen | GM-Tg-g-T77009-Ag | PRDX5 protein |
ORF Viral Vector | pGMLP002999 | Human PRDX5 Lentivirus plasmid |
ORF Viral Vector | vGMLP002999 | Human PRDX5 Lentivirus particle |
Target information
Target ID | GM-T77009 |
Target Name | PRDX5 |
Gene ID | 25824, 54683, 719764, 113898, 101093462, 476032, 282885, 100055657 |
Gene Symbol and Synonyms | ACR1,AOEB166,AOPP,B166,HEL-S-55,PLP,PMP20,PRDX5,PRDX6,Prx V,prx-V,PRXV,SBBI10 |
Uniprot Accession | P30044 |
Uniprot Entry Name | PRDX5_HUMAN |
Protein Sub-location | Introcelluar Protein |
Category | Therapeutics Target |
Disease | Not Available |
Gene Ensembl | ENSG00000126432 |
Target Classification | Not Available |
This gene encodes a member of the peroxiredoxin family of antioxidant enzymes, which reduce hydrogen peroxide and alkyl hydroperoxides. The encoded protein interacts with peroxisome receptor 1 and plays an antioxidant protective role in different tissues under normal conditions and during inflammatory processes. The use of alternate transcription start sites is thought to result in transcript variants that use different in-frame translational start codons to generate isoforms that are targeted to the mitochondrion (isoform L) or peroxisome/cytoplasm (isoform S). Multiple related pseudogenes have been defined for this gene. [provided by RefSeq, Nov 2017]
About GMVC
GMVC (GM Vector Core) is GeneMedi’s unique platform for QbD Viral vectors Processes development and manufacturing. In GMVC, our core expertise lies in the tailored production of viral vectors, including adeno-associated virus (AAV), lentivirus, and adenovirus. Our state-of-the-art facilities are equipped for scalable manufacturing, ensuring high-quality viral vector production to meet both research and therapeutic needs. Our expert team specializes in process development, leveraging innovative technology and extensive industry knowledge to provide clients with tailored solutions that exceed expectations. GMVC will be the ideal partner for scientists and healthcare professionals seeking reliable and efficient viral vector production services.