Human GDF9 ORF/cDNA clone-Lentivirus plasmid (NM_005260)

Pre-made Human GDF9/ Lentiviral expression plasmid for GDF9 lentivirus packaging, GDF9 lentivirus production, overexpression stable cell line development, cell transient transfection and gene delivery targeting T/B/NK cells, macrophages, cardiomyocytes, hepatocytes, and neurons.

Our GM-Lentiviral vector is seamlessly integrated with the GM lentivirus packaging system. Discover more about the GM lentivirus packaging system.

Target products collectionGo to GDF9/ products collection >>
(antibodies, antigen, VLP, mRNA, ORF viral vector, etc)



Product information

Catalog No. Product Name Plasmid Grade Plasmid quantity
pGMLP003024 Human GDF9 Lentivirus plasmid Research Grade 10mg, 50mg, 100mg, 500mg, >1g
GMP-like Grade 10mg, 50mg, 100mg, 500mg, >1g
High Quality (HQ) Grade
Seed 5ug


Product Description

Catalog ID pGMLP003024
Gene Name GDF9
Accession Number NM_005260
Gene ID 2661
Species Human
Product Type Lentivirus plasmid (overexpression)
Insert Length 1365 bp
Gene Alias
Fluorescent Reporter ZsGreen
Mammalian Cell Selection Puromyocin
Fusion Tag 3xflag (C-Terminal)
Promoter CMV
Resistance Amplicin
Sequence ATGGCACGTCCCAACAAATTCCTCCTTTGGTTTTGCTGCTTTGCCTGGCTGTGTTTTCCTATTAGCCTTGGTTCTCAGGCTTCTGGGGGAGAAGCTCAGATTGCTGCTAGTGCTGAGTTGGAATCTGGGGCTATGCCTTGGTCCTTGCTGCAGCATATAGATGAGAGAGACAGAGCTGGCCTCCTTCCCGCGCTTTTCAAAGTTCTATCTGTTGGGCGAGGTGGGTCACCTAGGCTGCAGCCAGACTCCAGAGCTTTGCACTACATGAAGAAGCTCTATAAGACATATGCTACCAAGGAAGGGATTCCTAAATCCAATAGAAGTCACCTCTACAACACTGTTCGGCTCTTCACCCCCTGTACCCGGCACAAGCAGGCTCCTGGAGACCAGGTAACAGGAATCCTTCCATCAGTGGAACTGCTATTTAACCTGGATCGCATTACTACCGTTGAACACTTACTCAAGTCAGTCTTGCTGTACAATATCAACAACTCAGTTTCTTTTTCCTCTGCTGTCAAATGTGTGTGCAATCTAATGATAAAGGAGCCAAAGTCTTCTAGCAGGACTCTCGGCAGAGCTCCATACTCATTTACCTTTAACTCACAGTTTGAATTTGGAAAGAAACACAAATGGATTCAGATTGATGTGACCAGCCTCCTTCAACCTTTAGTGGCCTCCAACAAGAGAAGTATTCACATGTCTATAAATTTTACTTGCATGAAAGACCAGCTGGAGCATCCTTCAGCACAGAATGGTTTGTTTAACATGACTCTGGTGTCCCCCTCACTGATCTTATATTTGAATGACACAAGTGCTCAGGCTTATCACAGCTGGTATTCCCTTCACTATAAAAGGAGGCCTTCCCAGGGTCCTGACCAGGAGAGAAGTCTGTCTGCCTATCCTGTGGGAGAAGAGGCTGCTGAGGATGGGAGATCTTCCCATCACCGTCACCGCAGAGGTCAGGAAACTGTCAGTTCTGAATTGAAGAAGCCCTTGGGCCCAGCTTCCTTCAATCTGAGTGAATACTTCAGACAATTTCTTCTTCCCCAAAATGAGTGTGAGCTCCATGACTTTAGACTTAGCTTTAGTCAGCTGAAGTGGGACAACTGGATTGTGGCTCCGCACAGGTACAACCCTCGATACTGTAAAGGGGACTGTCCAAGGGCAGTTGGACATCGGTATGGCTCTCCAGTTCACACCATGGTACAGAACATCATCTATGAGAAGCTGGACTCCTCAGTGCCAAGACCGTCATGTGTACCTGCCAAATACAGCCCCTTGAGTGTTTTGACCATTGAGCCCGATGGCTCAATTGCCTATAAAGAGTACGAAGATATGATAGCTACAAAGTGCACCTGTCGTTAA

Reference




    Data / case study


    Click to get more Data / Case study about the product.



    Associated products


    Category Cat No. Products Name
    Target Antibody GM-Tg-g-SE0241-Ab Anti-GDF9/ POF14 functional antibody
    Target Antigen GM-Tg-g-SE0241-Ag GDF9 protein
    Cytokine cks-Tg-g-GM-SE0241 growth differentiation factor 9 (GDF9) protein & antibody
    ORF Viral Vector pGMLP003024 Human GDF9 Lentivirus plasmid
    ORF Viral Vector vGMLP003024 Human GDF9 Lentivirus particle


    Target information

    Target ID GM-SE0241
    Target Name GDF9
    Gene ID 2661, 14566, 712792, 59304, 100306942, 100313495, 282574, 100072822
    Gene Symbol and Synonyms Gdf-9,GDF9,POF14
    Uniprot Accession O60383
    Uniprot Entry Name GDF9_HUMAN
    Protein Sub-location Secreted Protein/Potential Cytokines
    Category Cytokine Target
    Disease Not Available
    Gene Ensembl ENSG00000164404
    Target Classification Not Available

    This gene encodes a secreted ligand of the TGF-beta (transforming growth factor-beta) superfamily of proteins. Ligands of this family bind various TGF-beta receptors leading to recruitment and activation of SMAD family transcription factors that regulate gene expression. The encoded preproprotein is proteolytically processed to generate each subunit of the disulfide-linked homodimer. This protein regulates ovarian function. Reduced expression of this gene may be associated with polycystic ovary syndrome and mutations in this gene may be more common in mothers of dizygotic twins. [provided by RefSeq, Jul 2016]



    About GMVC

    GDU



    GMVC (GM Vector Core) is GeneMedi’s unique platform for QbD Viral vectors Processes development and manufacturing. In GMVC, our core expertise lies in the tailored production of viral vectors, including adeno-associated virus (AAV), lentivirus, and adenovirus. Our state-of-the-art facilities are equipped for scalable manufacturing, ensuring high-quality viral vector production to meet both research and therapeutic needs. Our expert team specializes in process development, leveraging innovative technology and extensive industry knowledge to provide clients with tailored solutions that exceed expectations. GMVC will be the ideal partner for scientists and healthcare professionals seeking reliable and efficient viral vector production services.