Human CA1/CA-I/ CAB ORF/cDNA clone-Lentivirus plasmid (NM_001738)
Pre-made Human CA1/CA-I/ CAB Lentiviral expression plasmid for CA1 lentivirus packaging, CA1 lentivirus production, overexpression stable cell line development, cell transient transfection and gene delivery targeting T/B/NK cells, macrophages, cardiomyocytes, hepatocytes, and neurons.
Our GM-Lentiviral vector is seamlessly integrated with the GM lentivirus packaging system. Discover more about the GM lentivirus packaging system.
Go
to CA-I/CA1 products collection
>>
(antibodies,
antigen, VLP, mRNA, ORF viral vector, etc)
Product information
Catalog No. | Product Name | Plasmid Grade | Plasmid quantity |
---|---|---|---|
pGMLP003029 | Human CA1 Lentivirus plasmid | Research Grade | 10mg, 50mg, 100mg, 500mg, >1g |
GMP-like Grade | 10mg, 50mg, 100mg, 500mg, >1g | ||
High Quality (HQ) Grade | |||
Seed | 5ug |
Product Description
Catalog ID | pGMLP003029 |
Gene Name | CA1 |
Accession Number | NM_001738 |
Gene ID | 759 |
Species | Human |
Product Type | Lentivirus plasmid (overexpression) |
Insert Length | 786 bp |
Gene Alias | CA-I, CAB, Car1, HEL-S-11 |
Fluorescent Reporter | ZsGreen |
Mammalian Cell Selection | Puromyocin |
Fusion Tag | 3xflag (C-Terminal) |
Promoter | CMV |
Resistance | Amplicin |
Sequence | ATGGCAAGTCCAGACTGGGGATATGATGACAAAAATGGTCCTGAACAATGGAGCAAGCTGTATCCCATTGCCAATGGAAATAACCAGTCCCCTGTTGATATTAAAACCAGTGAAACCAAACATGACACCTCTCTGAAACCTATTAGTGTCTCCTACAACCCAGCCACAGCCAAAGAAATTATCAATGTGGGGCATTCCTTCCATGTAAATTTTGAGGACAACGATAACCGATCAGTGCTGAAAGGTGGTCCTTTCTCTGACAGCTACAGGCTCTTTCAGTTCCATTTTCACTGGGGCAGTACAAATGAGCATGGTTCAGAACATACAGTGGATGGAGTCAAATATTCTGCCGAGCTTCACGTAGCTCACTGGAATTCTGCAAAGTACTCCAGCCTTGCTGAAGCTGCCTCAAAGGCTGATGGTTTGGCAGTTATTGGTGTTTTGATGAAGGTTGGTGAGGCCAACCCAAAGCTGCAGAAAGTACTTGATGCCCTCCAAGCAATTAAAACCAAGGGCAAACGAGCCCCATTCACAAATTTTGACCCCTCTACTCTCCTTCCTTCATCCCTGGATTTCTGGACCTACCCTGGCTCTCTGACTCATCCTCCTCTTTATGAGAGTGTAACTTGGATCATCTGTAAGGAGAGCATCAGTGTCAGCTCAGAGCAGCTGGCACAATTCCGCAGCCTTCTATCAAATGTTGAAGGTGATAACGCTGTCCCCATGCAGCACAACAACCGCCCAACCCAACCTCTGAAGGGCAGAACAGTGAGAGCTTCATTTTGA |
Reference
Data / case study
Click to get more Data / Case study about the product.
Associated products
Category | Cat No. | Products Name |
---|---|---|
Target Antibody | GM-Tg-g-T13201-Ab | Anti-CA-I monoclonal antibody |
Target Antigen | GM-Tg-g-T13201-Ag | CA-I/CA1 protein |
ORF Viral Vector | pGMLP003029 | Human CA1 Lentivirus plasmid |
ORF Viral Vector | vGMLP003029 | Human CA1 Lentivirus particle |
Target information
Target ID | GM-T13201 |
Target Name | CA-I |
Gene ID | 759, 12346, 703701, 310218, 101094399, 487031, 100050192 |
Gene Symbol and Synonyms | CA-I,CA1,CAB,Car-1,Car1,HEL-S-11 |
Uniprot Accession | P00915 |
Uniprot Entry Name | CAH1_HUMAN |
Protein Sub-location | Introcelluar Protein |
Category | Therapeutics Target |
Disease | Dent disease, Malignant neoplasm of bladder |
Gene Ensembl | ENSG00000133742 |
Target Classification | Not Available |
Carbonic anhydrases (CAs) are a large family of zinc metalloenzymes that catalyze the reversible hydration of carbon dioxide. They participate in a variety of biological processes, including respiration, calcification, acid-base balance, bone resorption, and the formation of aqueous humor, cerebrospinal fluid, saliva and gastric acid. They show extensive diversity in tissue distribution and in their subcellular localization. This CA1 gene is closely linked to the CA2 and CA3 genes on chromosome 8. It encodes a cytosolic protein that is found at the highest level in erythrocytes. Allelic variants of this gene have been described in some populations. Alternative splicing and the use of alternative promoters results in multiple transcript variants. [provided by RefSeq, Nov 2016]
About GMVC
GMVC (GM Vector Core) is GeneMedi’s unique platform for QbD Viral vectors Processes development and manufacturing. In GMVC, our core expertise lies in the tailored production of viral vectors, including adeno-associated virus (AAV), lentivirus, and adenovirus. Our state-of-the-art facilities are equipped for scalable manufacturing, ensuring high-quality viral vector production to meet both research and therapeutic needs. Our expert team specializes in process development, leveraging innovative technology and extensive industry knowledge to provide clients with tailored solutions that exceed expectations. GMVC will be the ideal partner for scientists and healthcare professionals seeking reliable and efficient viral vector production services.