Human CA1/CA-I/ CAB ORF/cDNA clone-Lentivirus particle (NM_001738)

Pre-made Human CA1/CA-I/ CAB Lentiviral expression plasmid for CA1 lentivirus packaging, CA1 lentivirus production, overexpression stable cell line development, cell transient transfection and gene delivery targeting T/B/NK cells, macrophages, cardiomyocytes, hepatocytes, and neurons.

The GM Vector Core (GMVC) specializes in custom lentivirus development and offers a range of lentivirus manufacturing solutions, leveraging state-of-the-art processes. Learn more about our services.

Target products collectionGo to CA-I/CA1 products collection >>
(antibodies, antigen, VLP, mRNA, ORF viral vector, etc)



Product information

Catalog No. Product Name lentivirus Grade lentivirus quantity
vGMLP003029 Human CA1 Lentivirus particle Pilot Grade 1.0E+8TU
5.0E+8TU
1.0E+9TU
Research Grade 1.0E+8TU
5.0E+8TU
1.0E+9TU
GMP-like Grade inquiry
GMP Grade inquiry


Product Description

Catalog ID vGMLP003029
Gene Name CA1
Accession Number NM_001738
Gene ID 759
Species Human
Product Type Lentivirus particle (overexpression)
Insert Length 786 bp
Gene Alias CA-I, CAB, Car1, HEL-S-11
Fluorescent Reporter ZsGreen
Mammalian Cell Selection Puromyocin
Fusion Tag 3xflag (C-Terminal)
Promoter CMV
Resistance Amplicin
Sequence ATGGCAAGTCCAGACTGGGGATATGATGACAAAAATGGTCCTGAACAATGGAGCAAGCTGTATCCCATTGCCAATGGAAATAACCAGTCCCCTGTTGATATTAAAACCAGTGAAACCAAACATGACACCTCTCTGAAACCTATTAGTGTCTCCTACAACCCAGCCACAGCCAAAGAAATTATCAATGTGGGGCATTCCTTCCATGTAAATTTTGAGGACAACGATAACCGATCAGTGCTGAAAGGTGGTCCTTTCTCTGACAGCTACAGGCTCTTTCAGTTCCATTTTCACTGGGGCAGTACAAATGAGCATGGTTCAGAACATACAGTGGATGGAGTCAAATATTCTGCCGAGCTTCACGTAGCTCACTGGAATTCTGCAAAGTACTCCAGCCTTGCTGAAGCTGCCTCAAAGGCTGATGGTTTGGCAGTTATTGGTGTTTTGATGAAGGTTGGTGAGGCCAACCCAAAGCTGCAGAAAGTACTTGATGCCCTCCAAGCAATTAAAACCAAGGGCAAACGAGCCCCATTCACAAATTTTGACCCCTCTACTCTCCTTCCTTCATCCCTGGATTTCTGGACCTACCCTGGCTCTCTGACTCATCCTCCTCTTTATGAGAGTGTAACTTGGATCATCTGTAAGGAGAGCATCAGTGTCAGCTCAGAGCAGCTGGCACAATTCCGCAGCCTTCTATCAAATGTTGAAGGTGATAACGCTGTCCCCATGCAGCACAACAACCGCCCAACCCAACCTCTGAAGGGCAGAACAGTGAGAGCTTCATTTTGA

Reference




    Data / case study


    Click to get more Data / Case study about the product.



    Associated products


    Category Cat No. Products Name
    Target Antibody GM-Tg-g-T13201-Ab Anti-CA-I monoclonal antibody
    Target Antigen GM-Tg-g-T13201-Ag CA-I/CA1 protein
    ORF Viral Vector pGMLP003029 Human CA1 Lentivirus plasmid
    ORF Viral Vector vGMLP003029 Human CA1 Lentivirus particle


    Target information

    Target ID GM-T13201
    Target Name CA-I
    Gene ID 759, 12346, 703701, 310218, 101094399, 487031, 100050192
    Gene Symbol and Synonyms CA-I,CA1,CAB,Car-1,Car1,HEL-S-11
    Uniprot Accession P00915
    Uniprot Entry Name CAH1_HUMAN
    Protein Sub-location Introcelluar Protein
    Category Therapeutics Target
    Disease Dent disease, Malignant neoplasm of bladder
    Gene Ensembl ENSG00000133742
    Target Classification Not Available

    Carbonic anhydrases (CAs) are a large family of zinc metalloenzymes that catalyze the reversible hydration of carbon dioxide. They participate in a variety of biological processes, including respiration, calcification, acid-base balance, bone resorption, and the formation of aqueous humor, cerebrospinal fluid, saliva and gastric acid. They show extensive diversity in tissue distribution and in their subcellular localization. This CA1 gene is closely linked to the CA2 and CA3 genes on chromosome 8. It encodes a cytosolic protein that is found at the highest level in erythrocytes. Allelic variants of this gene have been described in some populations. Alternative splicing and the use of alternative promoters results in multiple transcript variants. [provided by RefSeq, Nov 2016]



    About GMVC

    GDU



    GMVC (GM Vector Core) is GeneMedi’s unique platform for QbD Viral vectors Processes development and manufacturing. In GMVC, our core expertise lies in the tailored production of viral vectors, including adeno-associated virus (AAV), lentivirus, and adenovirus. Our state-of-the-art facilities are equipped for scalable manufacturing, ensuring high-quality viral vector production to meet both research and therapeutic needs. Our expert team specializes in process development, leveraging innovative technology and extensive industry knowledge to provide clients with tailored solutions that exceed expectations. GMVC will be the ideal partner for scientists and healthcare professionals seeking reliable and efficient viral vector production services.