Human DDRGK1/C20orf116/dJ1187M17.3 ORF/cDNA clone-Lentivirus plasmid (NM_023935)

Cat. No.: pGMLP003177
Size: 10 µg
Concentration: generally 0.5ug/ul, usually not less than 0.3ug/ul
Leading Time: 3-7 working days

Pre-made Human DDRGK1/C20orf116/dJ1187M17.3 Lentiviral expression plasmid for DDRGK1 lentivirus packaging, DDRGK1 lentivirus production, overexpression stable cell line development, cell transient transfection and gene delivery targeting T/B/NK cells, macrophages, cardiomyocytes, hepatocytes, and neurons.

Our GM-Lentiviral vector is seamlessly integrated with the GM lentivirus packaging system. Discover more about the GM lentivirus packaging system.

pdf Datasheet
pdf MSDS
pdf Terms of Use
Target products collection

Go to DDRGK1/C20orf116 products collection>>
(antibodies, antigen, VLP, mRNA, ORF viral vector, etc)

Purchase
Total Price: $536.25
Shipping fee: Limited-time free
For payment issues, contact us.


Product Description

Catalog ID pGMLP003177
Gene Name DDRGK1
Accession Number NM_023935
Gene ID 65992
Species Human
Product Type Lentivirus plasmid (overexpression)
Insert Length 945 bp
Gene Alias C20orf116,dJ1187M17.3,SEMDSH,UFBP1
Fluorescent Reporter ZsGreen
Mammalian Cell Selection Puromyocin
Fusion Tag 3xflag (C-Terminal)
Promoter CMV
Resistance Amplicin
ORF Nucleotide Sequence ATGGTGGCGCCTGTGTGGTACTTGGTAGCGGCGGCTCTGCTAGTCGGCTTTATCCTCTTCCTGACTCGCAGCCGGGGCCGGGCGGCATCAGCCGGCCAAGAGCCACTGCACAATGAGGAGCTGGCAGGAGCAGGCCGGGTGGCCCAGCCTGGGCCCCTGGAGCCTGAGGAGCCGAGAGCTGGAGGCAGGCCTCGGCGCCGGAGGGACCTGGGCAGCCGCCTACAGGCCCAGCGTCGAGCCCAGCGGGTGGCCTGGGCAGAAGCAGATGAGAACGAGGAGGAAGCTGTCATCCTAGCCCAGGAGGAGGAAGGTGTCGAGAAGCCAGCGGAAACTCACCTGTCGGGGAAAATTGGAGCTAAGAAACTGCGGAAGCTGGAGGAGAAACAAGCGCGAAAGGCCCAGCGTGAGGCAGAGGAGGCTGAACGTGAGGAGCGGAAACGACTCGAGTCCCAGCGCGAAGCTGAGTGGAAGAAGGAGGAGGAGCGGCTTCGCCTGGAGGAGGAGCAGAAGGAGGAGGAGGAGAGGAAGGCCCGCGAGGAGCAGGCCCAGCGGGAGCATGAGGAGTACCTGAAACTGAAGGAGGCCTTTGTGGTGGAGGAGGAAGGCGTAGGAGAGACCATGACTGAGGAACAGTCCCAGAGCTTCCTGACAGAGTTCATCAACTACATCAAGCAGTCCAAGGTTGTGCTCTTGGAAGACCTGGCTTCCCAGGTGGGCCTACGCACTCAGGACACCATAAATCGCATCCAGGACCTGCTGGCTGAGGGGACTATAACAGGTGTGATTGACGACCGGGGCAAGTTCATCTACATAACCCCAGAGGAACTGGCCGCCGTGGCCAACTTCATCCGACAGCGGGGCCGGGTGTCCATCGCCGAGCTTGCCCAAGCCAGCAACTCCCTCATCGCCTGGGGCCGGGAGTCCCCTGCCCAAGCCCCAGCCTGA
ORF Protein Sequence MVAPVWYLVAAALLVGFILFLTRSRGRAASAGQEPLHNEELAGAGRVAQPGPLEPEEPRAGGRPRRRRDLGSRLQAQRRAQRVAWAEADENEEEAVILAQEEEGVEKPAETHLSGKIGAKKLRKLEEKQARKAQREAEEAEREERKRLESQREAEWKKEEERLRLEEEQKEEEERKAREEQAQREHEEYLKLKEAFVVEEEGVGETMTEEQSQSFLTEFINYIKQSKVVLLEDLASQVGLRTQDTINRIQDLLAEGTITGVIDDRGKFIYITPEELAAVANFIRQRGRVSIAELAQASNSLIAWGRESPAQAPA

Reference




    Data / case study


    Click to get more Data / Case study about the product.



    Associated products


    Category Cat No. Products Name
    Target Antibody GM-Tg-g-IP0675-Ab Anti-DDRGK1 monoclonal antibody
    Target Antigen GM-Tg-g-IP0675-Ag DDRGK1 protein
    ORF Viral Vector pGMLP003177 Human DDRGK1 Lentivirus plasmid
    ORF Viral Vector pGMPC001707 Human DDRGK1 Mammalian (Non-Viral Vector) plasmid
    ORF Viral Vector vGMLP003177 Human DDRGK1 Lentivirus particle


    Target information

    Target ID GM-IP0675
    Target Name DDRGK1
    Gene ID 65992, 77006, 717226, 296162, 101094750, 477173, 511144, 100066678
    Gene Symbol and Synonyms 1110001I20Rik,2600009E05Rik,C13H20ORF116,C20orf116,DDRGK1,dJ1187M17.3,RGD1309979,SEMDSH,UFBP1
    Uniprot Accession Q96HY6
    Uniprot Entry Name DDRGK_HUMAN
    Protein Sub-location Introcelluar Protein
    Category Not Available
    Disease Not Available
    Gene Ensembl ENSG00000198171
    Target Classification Not Available

    The protein encoded by this gene interacts with components of the ubiquitin fold modifier 1 conjugation pathway and helps prevent apoptosis in ER-stressed secretory tissues. In addition, the encoded protein regulates nuclear factor-κB activity. [provided by RefSeq, Dec 2015]



    About GMVC

    GDU

    GMVC (GM Vector Core) is GeneMedi’s unique platform for QbD Viral vectors Processes development and manufacturing. In GMVC, our core expertise lies in the tailored production of viral vectors, including adeno-associated virus (AAV), lentivirus, and adenovirus. Our state-of-the-art facilities are equipped for scalable manufacturing, ensuring high-quality viral vector production to meet both research and therapeutic needs. Our expert team specializes in process development, leveraging innovative technology and extensive industry knowledge to provide clients with tailored solutions that exceed expectations. GMVC will be the ideal partner for scientists and healthcare professionals seeking reliable and efficient viral vector production services.