Human SCARB2/AMRF/ CD36L2 ORF/cDNA clone-Lentivirus plasmid (NM_005506)
Pre-made Human SCARB2/AMRF/ CD36L2 Lentiviral expression plasmid for SCARB2 lentivirus packaging, SCARB2 lentivirus production, overexpression stable cell line development, cell transient transfection and gene delivery targeting T/B/NK cells, macrophages, cardiomyocytes, hepatocytes, and neurons.
Our GM-Lentiviral vector is seamlessly integrated with the GM lentivirus packaging system. Discover more about the GM lentivirus packaging system.
Go
to SCARB2/AMRF products collection
>>
(antibodies,
antigen, VLP, mRNA, ORF viral vector, etc)
Product information
Catalog No. | Product Name | Plasmid Grade | Plasmid quantity |
---|---|---|---|
pGMLP003191 | Human SCARB2 Lentivirus plasmid | Research Grade | 10mg, 50mg, 100mg, 500mg, >1g |
GMP-like Grade | 10mg, 50mg, 100mg, 500mg, >1g | ||
High Quality (HQ) Grade | |||
Seed | 5ug |
Product Description
Catalog ID | pGMLP003191 |
Gene Name | SCARB2 |
Accession Number | NM_005506 |
Gene ID | 950 |
Species | Human |
Product Type | Lentivirus plasmid (overexpression) |
Insert Length | 1437 bp |
Gene Alias | AMRF, CD36L2, EPM4, HLGP85, LGP85, LIMP-2, LIMPII, SR-BII |
Fluorescent Reporter | ZsGreen |
Mammalian Cell Selection | Puromyocin |
Fusion Tag | 3xflag (C-Terminal) |
Promoter | CMV |
Resistance | Amplicin |
Sequence | ATGGGCCGATGCTGCTTCTACACGGCGGGGACGTTGTCCCTGCTCCTGCTGGTGACCAGCGTCACGCTGCTGGTGGCCCGGGTCTTCCAGAAGGCTGTAGACCAGAGTATCGAGAAGAAAATTGTGTTAAGGAATGGTACTGAGGCATTTGACTCCTGGGAGAAGCCCCCTCTGCCTGTGTATACTCAGTTCTATTTCTTCAATGTCACCAATCCAGAGGAGATCCTCAGAGGGGAGACCCCTCGGGTGGAAGAAGTGGGGCCATACACCTACAGGGAACTCAGAAACAAAGCAAATATTCAATTTGGAGATAATGGAACAACAATATCTGCTGTTAGCAACAAGGCCTATGTTTTTGAACGAGACCAATCTGTTGGAGACCCTAAAATTGACTTAATTAGAACATTAAATATTCCTGTATTGACTGTCATAGAGTGGTCCCAGGTGCACTTCCTCAGGGAGATCATCGAGGCCATGTTGAAAGCCTATCAGCAGAAGCTCTTTGTGACTCACACAGTTGACGAATTGCTCTGGGGCTACAAAGATGAAATCTTGTCCCTTATCCATGTTTTCAGGCCCGATATCTCTCCCTATTTTGGCCTATTCTATGAGAAAAATGGGACTAATGATGGAGACTATGTTTTTCTAACTGGAGAAGACAGTTACCTTAACTTTACAAAAATTGTGGAATGGAATGGGAAAACGTCACTTGACTGGTGGATAACAGACAAGTGCAATATGATTAATGGAACAGATGGAGATTCTTTTCACCCACTAATAACCAAAGATGAGGTCCTTTATGTCTTCCCATCTGACTTTTGCAGGTCAGTGTATATTACTTTCAGTGACTATGAGAGTGTACAGGGACTGCCTGCCTTTCGGTATAAAGTTCCTGCAGAAATATTAGCCAATACGTCAGACAATGCCGGCTTCTGTATACCTGAGGGAAACTGCCTGGGCTCAGGAGTTCTGAATGTCAGCATCTGCAAGAATGGTGCACCCATCATTATGTCTTTCCCACACTTTTACCAAGCAGATGAGAGGTTTGTTTCTGCCATAGAAGGCATGCACCCAAATCAGGAAGACCATGAGACATTTGTGGACATTAATCCTTTGACTGGAATAATCCTAAAAGCAGCCAAGAGGTTCCAAATCAACATTTATGTCAAAAAATTAGATGACTTTGTTGAAACGGGAGACATTAGAACCATGGTTTTCCCAGTGATGTACCTCAATGAGAGTGTTCACATTGATAAAGAGACGGCGAGTCGACTGAAGTCTATGATTAACACTACTTTGATCATCACCAACATACCCTACATCATCATGGCGCTGGGTGTGTTCTTTGGTTTGGTTTTTACCTGGCTTGCATGCAAAGGACAGGGATCCATGGATGAGGGAACAGCGGATGAAAGAGCACCCCTCATTCGAACCTAA |
Reference
Data / case study
Click to get more Data / Case study about the product.
Associated products
Category | Cat No. | Products Name |
---|---|---|
Target Antibody | GM-Tg-g-MP1483-Ab | Anti-SCRB2/ SCARB2/ AMRF monoclonal antibody |
Target Antigen | GM-Tg-g-MP1483-Ag | SCARB2 VLP (virus-like particle) |
ORF Viral Vector | pGMAD000184 | Human SCARB2 Adenovirus plasmid |
ORF Viral Vector | pGMLP003191 | Human SCARB2 Lentivirus plasmid |
ORF Viral Vector | vGMAD000184 | Human SCARB2 Adenovirus particle |
ORF Viral Vector | vGMLP003191 | Human SCARB2 Lentivirus particle |
Target information
Target ID | GM-MP1483 |
Target Name | SCARB2 |
Gene ID | 950, 12492, 699990, 117106, 101098789, 478435, 533177, 100058151 |
Gene Symbol and Synonyms | 9330185J12Rik,AMRF,CD36L2,EPM4,HLGP85,LGP85,LIMP II,LIMP-2,LIMPII,MLGP85,SCARB2,SR-BII |
Uniprot Accession | Q14108 |
Uniprot Entry Name | SCRB2_HUMAN |
Protein Sub-location | Transmembrane Protein |
Category | Not Available |
Disease | Not Available |
Gene Ensembl | ENSG00000138760 |
Target Classification | Not Available |
The protein encoded by this gene is a type III glycoprotein that is located primarily in limiting membranes of lysosomes and endosomes. Earlier studies in mice and rat suggested that this protein may participate in membrane transportation and the reorganization of endosomal/lysosomal compartment. The protein deficiency in mice was reported to impair cell membrane transport processes and cause pelvic junction obstruction, deafness, and peripheral neuropathy. Further studies in human showed that this protein is a ubiquitously expressed protein and that it is involved in the pathogenesis of HFMD (hand, foot, and mouth disease) caused by enterovirus-71 and possibly by coxsackievirus A16. Mutations in this gene caused an autosomal recessive progressive myoclonic epilepsy-4 (EPM4), also known as action myoclonus-renal failure syndrome (AMRF). Alternatively spliced transcript variants encoding different isoforms have been found for this gene.[provided by RefSeq, Feb 2011]
About GMVC
GMVC (GM Vector Core) is GeneMedi’s unique platform for QbD Viral vectors Processes development and manufacturing. In GMVC, our core expertise lies in the tailored production of viral vectors, including adeno-associated virus (AAV), lentivirus, and adenovirus. Our state-of-the-art facilities are equipped for scalable manufacturing, ensuring high-quality viral vector production to meet both research and therapeutic needs. Our expert team specializes in process development, leveraging innovative technology and extensive industry knowledge to provide clients with tailored solutions that exceed expectations. GMVC will be the ideal partner for scientists and healthcare professionals seeking reliable and efficient viral vector production services.