Human MAS1/MAS/ MGRA ORF/cDNA clone-Lentivirus plasmid (NM_002377)

Pre-made Human MAS1/MAS/ MGRA Lentiviral expression plasmid for MAS1 lentivirus packaging, MAS1 lentivirus production, overexpression stable cell line development, cell transient transfection and gene delivery targeting T/B/NK cells, macrophages, cardiomyocytes, hepatocytes, and neurons.

Our GM-Lentiviral vector is seamlessly integrated with the GM lentivirus packaging system. Discover more about the GM lentivirus packaging system.

Target products collectionGo to MAS/MAS1 products collection >>
(antibodies, antigen, VLP, mRNA, ORF viral vector, etc)



Product information

Catalog No. Product Name Plasmid Grade Plasmid quantity
pGMLP003192 Human MAS1 Lentivirus plasmid Research Grade 10mg, 50mg, 100mg, 500mg, >1g
GMP-like Grade 10mg, 50mg, 100mg, 500mg, >1g
High Quality (HQ) Grade
Seed 5ug


Product Description

Catalog ID pGMLP003192
Gene Name MAS1
Accession Number NM_002377
Gene ID 4142
Species Human
Product Type Lentivirus plasmid (overexpression)
Insert Length 978 bp
Gene Alias MAS, MGRA
Fluorescent Reporter ZsGreen
Mammalian Cell Selection Puromyocin
Fusion Tag 3xflag (C-Terminal)
Promoter CMV
Resistance Amplicin
Sequence ATGGATGGGTCAAACGTGACATCATTTGTTGTTGAGGAACCCACGAACATCTCAACTGGCAGGAACGCCTCAGTCGGGAATGCACATCGGCAAATCCCCATCGTGCACTGGGTCATTATGAGCATCTCCCCAGTGGGGTTTGTTGAGAATGGGATTCTCCTCTGGTTCCTGTGCTTCCGGATGAGAAGAAATCCCTTCACTGTCTACATCACCCACCTGTCTATCGCAGACATCTCACTGCTCTTCTGTATTTTCATCTTGTCTATCGACTATGCTTTAGATTATGAGCTTTCTTCTGGCCATTACTACACAATTGTCACATTATCAGTGACTTTTCTGTTTGGCTACAACACGGGCCTCTATCTGCTGACGGCCATTAGTGTGGAGAGGTGCCTGTCAGTCCTTTACCCCATCTGGTACCGATGCCATCGCCCCAAGTACCAGTCGGCATTGGTCTGTGCCCTTCTGTGGGCTCTTTCTTGCTTGGTGACCACCATGGAGTATGTCATGTGCATCGACAGAGAAGAAGAGAGTCACTCTCGGAATGACTGCCGAGCAGTCATCATCTTTATAGCCATCCTGAGCTTCCTGGTCTTCACGCCCCTCATGCTGGTGTCCAGCACCATCTTGGTCGTGAAGATCCGGAAGAACACGTGGGCTTCCCATTCCTCCAAGCTTTACATAGTCATCATGGTCACCATCATTATATTCCTCATCTTCGCTATGCCCATGAGACTCCTTTACCTGCTGTACTATGAGTATTGGTCGACCTTTGGGAACCTACACCACATTTCCCTGCTCTTCTCCACAATCAACAGTAGCGCCAACCCTTTCATTTACTTCTTTGTGGGAAGCAGTAAGAAGAAGAGATTCAAGGAGTCCTTAAAAGTTGTTCTGACCAGGGCTTTCAAAGATGAAATGCAACCTCGGCGCCAGAAAGACAATTGTAATACGGTCACAGTTGAGACTGTCGTCTAA

Reference




    Data / case study


    Click to get more Data / Case study about the product.



    Associated products


    Category Cat No. Products Name
    Target Antibody GM-Tg-g-T91894-Ab Anti-MAS/ MAS1/ MGRA monoclonal antibody
    Target Antigen GM-Tg-g-T91894-Ag MAS/MAS1 VLP (virus-like particle)
    ORF Viral Vector pGMLP003192 Human MAS1 Lentivirus plasmid
    ORF Viral Vector vGMLP003192 Human MAS1 Lentivirus particle


    Target information

    Target ID GM-T91894
    Target Name MAS
    Gene ID 4142, 17171, 703105, 25153, 101094352, 484066, 783010, 111771416
    Gene Symbol and Synonyms c-mas,MAS,Mas-1,MAS1,MasR,MGRA
    Uniprot Accession P04201
    Uniprot Entry Name MAS_HUMAN
    Protein Sub-location Transmembrane Protein
    Category Therapeutics Target
    Disease Cancer
    Gene Ensembl ENSG00000130368
    Target Classification Tumor-associated antigen (TAA)

    This gene encodes a class I seven-transmembrane G-protein-coupled receptor. The encoded protein is a receptor for angiotensin-(1-7) and preferentially couples to the Gq protein, activating the phospholipase C signaling pathway. The encoded protein may play a role in multiple processes including hypotension, smooth muscle relaxation and cardioprotection by mediating the effects of angiotensin-(1-7). [provided by RefSeq, May 2012]



    About GMVC

    GDU



    GMVC (GM Vector Core) is GeneMedi’s unique platform for QbD Viral vectors Processes development and manufacturing. In GMVC, our core expertise lies in the tailored production of viral vectors, including adeno-associated virus (AAV), lentivirus, and adenovirus. Our state-of-the-art facilities are equipped for scalable manufacturing, ensuring high-quality viral vector production to meet both research and therapeutic needs. Our expert team specializes in process development, leveraging innovative technology and extensive industry knowledge to provide clients with tailored solutions that exceed expectations. GMVC will be the ideal partner for scientists and healthcare professionals seeking reliable and efficient viral vector production services.