Human AGR3/AG-3/ AG3 ORF/cDNA clone-Lentivirus plasmid (NM_176813)
Pre-made Human AGR3/AG-3/ AG3 Lentiviral expression plasmid for AGR3 lentivirus packaging, AGR3 lentivirus production, overexpression stable cell line development, cell transient transfection and gene delivery targeting T/B/NK cells, macrophages, cardiomyocytes, hepatocytes, and neurons.
Our GM-Lentiviral vector is seamlessly integrated with the GM lentivirus packaging system. Discover more about the GM lentivirus packaging system.
Go
to AGR3/AG-3 products collection
>>
(antibodies,
antigen, VLP, mRNA, ORF viral vector, etc)
Product information
Catalog No. | Product Name | Plasmid Grade | Plasmid quantity |
---|---|---|---|
pGMLP003206 | Human AGR3 Lentivirus plasmid | Research Grade | 10mg, 50mg, 100mg, 500mg, >1g |
GMP-like Grade | 10mg, 50mg, 100mg, 500mg, >1g | ||
High Quality (HQ) Grade | |||
Seed | 5ug |
Product Description
Catalog ID | pGMLP003206 |
Gene Name | AGR3 |
Accession Number | NM_176813 |
Gene ID | 155465 |
Species | Human |
Product Type | Lentivirus plasmid (overexpression) |
Insert Length | 501 bp |
Gene Alias | AG-3, AG3, BCMP11, hAG-3, HAG3, PDIA18 |
Fluorescent Reporter | ZsGreen |
Mammalian Cell Selection | Puromyocin |
Fusion Tag | 3xflag (C-Terminal) |
Promoter | CMV |
Resistance | Amplicin |
Sequence | ATGATGCTACACTCAGCTTTGGGTCTCTGCCTCTTACTCGTCACAGTTTCTTCCAACCTTGCCATTGCAATAAAAAAGGAAAAGAGGCCTCCTCAGACACTCTCAAGAGGATGGGGAGATGACATCACTTGGGTACAAACTTATGAAGAAGGTCTCTTTTATGCTCAAAAAAGTAAGAAGCCATTAATGGTTATTCATCACCTGGAGGATTGTCAATACTCTCAAGCACTAAAGAAAGTATTTGCCCAAAATGAAGAAATACAAGAAATGGCTCAGAATAAGTTCATCATGCTAAACCTTATGCATGAAACCACTGATAAGAATTTATCACCTGATGGGCAATATGTGCCTAGAATCATGTTTGTAGACCCTTCTTTAACAGTTAGAGCTGACATAGCTGGAAGATACTCTAACAGATTGTACACATATGAGCCTCGGGATTTACCCCTATTGATAGAAAACATGAAGAAAGCATTAAGACTTATTCAGTCAGAGCTATAA |
Reference
Data / case study
Click to get more Data / Case study about the product.
Associated products
Category | Cat No. | Products Name |
---|---|---|
Target Antibody | GM-Tg-g-SE1605-Ab | Anti-AGR3/ AG-3/ AG3 functional antibody |
Target Antigen | GM-Tg-g-SE1605-Ag | AGR3 protein |
ORF Viral Vector | pGMAD000483 | Human AGR3 Adenovirus plasmid |
ORF Viral Vector | pGMLP003206 | Human AGR3 Lentivirus plasmid |
ORF Viral Vector | vGMAD000483 | Human AGR3 Adenovirus particle |
ORF Viral Vector | vGMLP003206 | Human AGR3 Lentivirus particle |
Target information
Target ID | GM-SE1605 |
Target Name | AGR3 |
Gene ID | 155465, 403205, 714517, 298959, 618371, 100066130 |
Gene Symbol and Synonyms | AG-3,AG3,AGR3,BCMP11,E030025L21Rik,Gm888,hAG-3,HAG3,PDIA18,RGD1565406 |
Uniprot Accession | Q8TD06 |
Uniprot Entry Name | AGR3_HUMAN |
Protein Sub-location | Secreted Protein/Potential Cytokines |
Category | Not Available |
Disease | Not Available |
Gene Ensembl | ENSG00000173467 |
Target Classification | Not Available |
This gene encodes a member of the disulfide isomerase (PDI) family of endoplasmic reticulum (ER) proteins that catalyze protein folding and thiol-disulfide interchange reactions. The encoded protein has an N-terminal ER-signal sequence, a catalytically active thioredoxin domain, and a C-terminal ER-retention sequence. This gene is expressed in ciliated airway epithelial cells and, in mouse, plays a role in ciliary beat frequency in multiciliated cells. This gene is also over-expressed in breast, ovarian, and prostrate cancers. [provided by RefSeq, Dec 2016]
About GMVC
GMVC (GM Vector Core) is GeneMedi’s unique platform for QbD Viral vectors Processes development and manufacturing. In GMVC, our core expertise lies in the tailored production of viral vectors, including adeno-associated virus (AAV), lentivirus, and adenovirus. Our state-of-the-art facilities are equipped for scalable manufacturing, ensuring high-quality viral vector production to meet both research and therapeutic needs. Our expert team specializes in process development, leveraging innovative technology and extensive industry knowledge to provide clients with tailored solutions that exceed expectations. GMVC will be the ideal partner for scientists and healthcare professionals seeking reliable and efficient viral vector production services.