Human AGR3/AG-3/ AG3 ORF/cDNA clone-Lentivirus particle (NM_176813)

Pre-made Human AGR3/AG-3/ AG3 Lentiviral expression plasmid for AGR3 lentivirus packaging, AGR3 lentivirus production, overexpression stable cell line development, cell transient transfection and gene delivery targeting T/B/NK cells, macrophages, cardiomyocytes, hepatocytes, and neurons.

The GM Vector Core (GMVC) specializes in custom lentivirus development and offers a range of lentivirus manufacturing solutions, leveraging state-of-the-art processes. Learn more about our services.

Target products collectionGo to AGR3/AG-3 products collection >>
(antibodies, antigen, VLP, mRNA, ORF viral vector, etc)



Product information

Catalog No. Product Name lentivirus Grade lentivirus quantity
vGMLP003206 Human AGR3 Lentivirus particle Pilot Grade 1.0E+8TU
5.0E+8TU
1.0E+9TU
Research Grade 1.0E+8TU
5.0E+8TU
1.0E+9TU
GMP-like Grade inquiry
GMP Grade inquiry


Product Description

Catalog ID vGMLP003206
Gene Name AGR3
Accession Number NM_176813
Gene ID 155465
Species Human
Product Type Lentivirus particle (overexpression)
Insert Length 501 bp
Gene Alias AG-3, AG3, BCMP11, hAG-3, HAG3, PDIA18
Fluorescent Reporter ZsGreen
Mammalian Cell Selection Puromyocin
Fusion Tag 3xflag (C-Terminal)
Promoter CMV
Resistance Amplicin
Sequence ATGATGCTACACTCAGCTTTGGGTCTCTGCCTCTTACTCGTCACAGTTTCTTCCAACCTTGCCATTGCAATAAAAAAGGAAAAGAGGCCTCCTCAGACACTCTCAAGAGGATGGGGAGATGACATCACTTGGGTACAAACTTATGAAGAAGGTCTCTTTTATGCTCAAAAAAGTAAGAAGCCATTAATGGTTATTCATCACCTGGAGGATTGTCAATACTCTCAAGCACTAAAGAAAGTATTTGCCCAAAATGAAGAAATACAAGAAATGGCTCAGAATAAGTTCATCATGCTAAACCTTATGCATGAAACCACTGATAAGAATTTATCACCTGATGGGCAATATGTGCCTAGAATCATGTTTGTAGACCCTTCTTTAACAGTTAGAGCTGACATAGCTGGAAGATACTCTAACAGATTGTACACATATGAGCCTCGGGATTTACCCCTATTGATAGAAAACATGAAGAAAGCATTAAGACTTATTCAGTCAGAGCTATAA

Reference




    Data / case study


    Click to get more Data / Case study about the product.



    Associated products


    Category Cat No. Products Name
    Target Antibody GM-Tg-g-SE1605-Ab Anti-AGR3/ AG-3/ AG3 functional antibody
    Target Antigen GM-Tg-g-SE1605-Ag AGR3 protein
    ORF Viral Vector pGMAD000483 Human AGR3 Adenovirus plasmid
    ORF Viral Vector pGMLP003206 Human AGR3 Lentivirus plasmid
    ORF Viral Vector vGMAD000483 Human AGR3 Adenovirus particle
    ORF Viral Vector vGMLP003206 Human AGR3 Lentivirus particle


    Target information

    Target ID GM-SE1605
    Target Name AGR3
    Gene ID 155465, 403205, 714517, 298959, 618371, 100066130
    Gene Symbol and Synonyms AG-3,AG3,AGR3,BCMP11,E030025L21Rik,Gm888,hAG-3,HAG3,PDIA18,RGD1565406
    Uniprot Accession Q8TD06
    Uniprot Entry Name AGR3_HUMAN
    Protein Sub-location Secreted Protein/Potential Cytokines
    Category Not Available
    Disease Not Available
    Gene Ensembl ENSG00000173467
    Target Classification Not Available

    This gene encodes a member of the disulfide isomerase (PDI) family of endoplasmic reticulum (ER) proteins that catalyze protein folding and thiol-disulfide interchange reactions. The encoded protein has an N-terminal ER-signal sequence, a catalytically active thioredoxin domain, and a C-terminal ER-retention sequence. This gene is expressed in ciliated airway epithelial cells and, in mouse, plays a role in ciliary beat frequency in multiciliated cells. This gene is also over-expressed in breast, ovarian, and prostrate cancers. [provided by RefSeq, Dec 2016]



    About GMVC

    GDU



    GMVC (GM Vector Core) is GeneMedi’s unique platform for QbD Viral vectors Processes development and manufacturing. In GMVC, our core expertise lies in the tailored production of viral vectors, including adeno-associated virus (AAV), lentivirus, and adenovirus. Our state-of-the-art facilities are equipped for scalable manufacturing, ensuring high-quality viral vector production to meet both research and therapeutic needs. Our expert team specializes in process development, leveraging innovative technology and extensive industry knowledge to provide clients with tailored solutions that exceed expectations. GMVC will be the ideal partner for scientists and healthcare professionals seeking reliable and efficient viral vector production services.