Human PTGER3/EP3/EP3-I ORF/cDNA clone-Lentivirus plasmid (NM_198716)

Cat. No.: pGMLP003229
Size: 10 µg
Concentration: generally 0.5ug/ul, usually not less than 0.3ug/ul
Leading Time: 3-7 working days

Pre-made Human PTGER3/EP3/EP3-I Lentiviral expression plasmid for PTGER3 lentivirus packaging, PTGER3 lentivirus production, overexpression stable cell line development, cell transient transfection and gene delivery targeting T/B/NK cells, macrophages, cardiomyocytes, hepatocytes, and neurons.

Our GM-Lentiviral vector is seamlessly integrated with the GM lentivirus packaging system. Discover more about the GM lentivirus packaging system.

pdf Datasheet
pdf MSDS
pdf Terms of Use
Target products collection

Go to PTGER3/EP3 products collection>>
(antibodies, antigen, VLP, mRNA, ORF viral vector, etc)

Purchase
Total Price: $615
Shipping fee: Limited-time free
For payment issues, contact us.


Product Description

Catalog ID pGMLP003229
Gene Name PTGER3
Accession Number NM_198716
Gene ID 5733
Species Human
Product Type Lentivirus plasmid (overexpression)
Insert Length 1125 bp
Gene Alias EP3,EP3-I,EP3-II,EP3-III,EP3-IV,EP3-VI,EP3e,PGE2-R
Fluorescent Reporter ZsGreen
Mammalian Cell Selection Puromyocin
Fusion Tag 3xflag (C-Terminal)
Promoter CMV
Resistance Amplicin
ORF Nucleotide Sequence ATGAAGGAGACCCGGGGCTACGGAGGGGATGCCCCCTTCTGCACCCGCCTCAACCACTCCTACACAGGCATGTGGGCGCCCGAGCGTTCCGCCGAGGCGCGGGGCAACCTCACGCGCCCTCCAGGGTCTGGCGAGGATTGCGGATCGGTGTCCGTGGCCTTCCCGATCACCATGCTGCTCACTGGTTTCGTGGGCAACGCACTGGCCATGCTGCTCGTGTCGCGCAGCTACCGGCGCCGGGAGAGCAAGCGCAAGAAGTCCTTCCTGCTGTGCATCGGCTGGCTGGCGCTCACCGACCTGGTCGGGCAGCTTCTCACCACCCCGGTCGTCATCGTCGTGTACCTGTCCAAGCAGCGTTGGGAGCACATCGACCCGTCGGGGCGGCTCTGCACCTTTTTCGGGCTGACCATGACTGTTTTCGGGCTCTCCTCGTTGTTCATCGCCAGCGCCATGGCCGTCGAGCGGGCGCTGGCCATCAGGGCGCCGCACTGGTATGCGAGCCACATGAAGACGCGTGCCACCCGCGCTGTGCTGCTCGGCGTGTGGCTGGCCGTGCTCGCCTTCGCCCTGCTGCCGGTGCTGGGCGTGGGCCAGTACACCGTCCAGTGGCCCGGGACGTGGTGCTTCATCAGCACCGGGCGAGGGGGCAACGGGACTAGCTCTTCGCATAACTGGGGCAACCTTTTCTTCGCCTCTGCCTTTGCCTTCCTGGGGCTCTTGGCGCTGACAGTCACCTTTTCCTGCAACCTGGCCACCATTAAGGCCCTGGTGTCCCGCTGCCGGGCCAAGGCCACGGCATCTCAGTCCAGTGCCCAGTGGGGCCGCATCACGACCGAGACGGCCATTCAGCTTATGGGGATCATGTGCGTGCTGTCGGTCTGCTGGTCTCCGCTCCTGATAATGATGTTGAAAATGATCTTCAATCAGACATCAGTTGAGCACTGCAAGACACACACGGAGAAGCAGAAAGAATGCAACTTCTTCTTAATAGCTGTTCGCCTGGCTTCACTGAACCAGATCTTGGATCCTTGGGTTTACCTGCTGTTAAGAAAGATCCTTCTTCGAAAGTTTTGCCAGATGAGAAAAAGAAGACTCAGAGAGCAAGAGGAATTTTGGGGAAATTAA
ORF Protein Sequence MKETRGYGGDAPFCTRLNHSYTGMWAPERSAEARGNLTRPPGSGEDCGSVSVAFPITMLLTGFVGNALAMLLVSRSYRRRESKRKKSFLLCIGWLALTDLVGQLLTTPVVIVVYLSKQRWEHIDPSGRLCTFFGLTMTVFGLSSLFIASAMAVERALAIRAPHWYASHMKTRATRAVLLGVWLAVLAFALLPVLGVGQYTVQWPGTWCFISTGRGGNGTSSSHNWGNLFFASAFAFLGLLALTVTFSCNLATIKALVSRCRAKATASQSSAQWGRITTETAIQLMGIMCVLSVCWSPLLIMMLKMIFNQTSVEHCKTHTEKQKECNFFLIAVRLASLNQILDPWVYLLLRKILLRKFCQMRKRRLREQEEFWGN

Reference




    Data / case study


    Click to get more Data / Case study about the product.



    Associated products


    Category Cat No. Products Name
    Target Antibody GM-Tg-g-T85467-Ab Anti-PE2R3/ PTGER3/ EP3 monoclonal antibody
    Target Antigen GM-Tg-g-T85467-Ag PTGER3 VLP (virus-like particle)
    ORF Viral Vector pGMLP003229 Human PTGER3 Lentivirus plasmid
    ORF Viral Vector vGMLP003229 Human PTGER3 Lentivirus particle


    Target information

    Target ID GM-T85467
    Target Name PTGER3
    Gene ID 5733, 19218, 703398, 24929, 101083952, 403430, 282330, 100053557
    Gene Symbol and Synonyms EP3,EP3-I,EP3-II,EP3-III,EP3-IV,EP3-VI,EP3e,EP3R,lnc003875,PGE2-R,Pgerep3,PTGER3,Ptgerep3,Rep3,rEP3a,rEP3b
    Uniprot Accession P43115
    Uniprot Entry Name PE2R3_HUMAN
    Protein Sub-location Transmembrane Protein
    Category Therapeutics Target
    Disease Not Available
    Gene Ensembl ENSG00000050628
    Target Classification GPCR

    The protein encoded by this gene is a member of the G-protein coupled receptor family. This protein is one of four receptors identified for prostaglandin E2 (PGE2). This receptor may have many biological functions, which involve digestion, nervous system, kidney reabsorption, and uterine contraction activities. Studies of the mouse counterpart suggest that this receptor may also mediate adrenocorticotropic hormone response as well as fever generation in response to exogenous and endogenous stimuli. Multiple transcript variants encoding different isoforms have been found for this gene. [provided by RefSeq, Aug 2009]



    About GMVC

    GDU

    GMVC (GM Vector Core) is GeneMedi’s unique platform for QbD Viral vectors Processes development and manufacturing. In GMVC, our core expertise lies in the tailored production of viral vectors, including adeno-associated virus (AAV), lentivirus, and adenovirus. Our state-of-the-art facilities are equipped for scalable manufacturing, ensuring high-quality viral vector production to meet both research and therapeutic needs. Our expert team specializes in process development, leveraging innovative technology and extensive industry knowledge to provide clients with tailored solutions that exceed expectations. GMVC will be the ideal partner for scientists and healthcare professionals seeking reliable and efficient viral vector production services.