Human SLC25A14/BMCP1/ UCP5 ORF/cDNA clone-Lentivirus plasmid (NM_001282195)

Pre-made Human SLC25A14/BMCP1/ UCP5 Lentiviral expression plasmid for SLC25A14 lentivirus packaging, SLC25A14 lentivirus production, overexpression stable cell line development, cell transient transfection and gene delivery targeting T/B/NK cells, macrophages, cardiomyocytes, hepatocytes, and neurons.

Our GM-Lentiviral vector is seamlessly integrated with the GM lentivirus packaging system. Discover more about the GM lentivirus packaging system.

Target products collectionGo to SLC25A14/BMCP1 products collection >>
(antibodies, antigen, VLP, mRNA, ORF viral vector, etc)



Product information

Catalog No. Product Name Plasmid Grade Plasmid quantity
pGMLP003260 Human SLC25A14 Lentivirus plasmid Research Grade 10mg, 50mg, 100mg, 500mg, >1g
GMP-like Grade 10mg, 50mg, 100mg, 500mg, >1g
High Quality (HQ) Grade
Seed 5ug


Product Description

Catalog ID pGMLP003260
Gene Name SLC25A14
Accession Number NM_001282195
Gene ID 9016
Species Human
Product Type Lentivirus plasmid (overexpression)
Insert Length 978 bp
Gene Alias BMCP1, UCP5
Fluorescent Reporter ZsGreen
Mammalian Cell Selection Puromyocin
Fusion Tag 3xflag (C-Terminal)
Promoter CMV
Resistance Amplicin
Sequence ATGGGTATCTTTCCCGGAATAATCCTAATTTTTCTAAGGGTGAAGTTTGCAACGGCGGCCGTGATTGTAAGCGGACACCAGAAAAGTACCACTGTAAGTCATGAGATGTCTGGTCTGAATTGGAAACCCTTTGTATATGGCGGCCTTGCCTCTATCGTGGCTGAGTTTGGGACTTTCCCTGTGGACCTTACCAAAACACGACTTCAGGTTCAAGGCCAAAGCATTGATGCCCGTTTCAAAGAGATAAAATATAGAGGGATGTTCCATGCGCTGTTTCGCATCTGTAAAGAGGAAGGTGTATTGGCTCTCTATTCAGGAATTGCTCCTGCGTTGCTAAGACAAGCATCATATGGCACCATTAAAATTGGGATTTACCAAAGCTTGAAGCGCTTATTCGTAGAACGTTTAGAAGATGAAACTCTTTTAATTAATATGATCTGTGGGGTAGTGTCAGGAGTGATATCTTCCACTATAGCCAATCCCACCGATGTTCTAAAGATTCGAATGCAGGCTCAAGGAAGCTTGTTCCAAGGGAGCATGATTGGAAGCTTTATCGATATATACCAACAAGAAGGCACCAGGGGTCTGTGGAGGGGTGTGGTTCCAACTGCTCAGCGTGCTGCCATCGTTGTAGGAGTAGAGCTACCAGTCTATGATATTACTAAGAAGCATTTAATATTGTCAGGAATGATGGGCGATACAATTTTAACTCACTTCGTTTCCAGCTTTACATGTGGTTTGGCTGGGGCTCTGGCCTCCAACCCGGTTGATGTGGTTCGAACTCGCATGATGAACCAGAGGGCAATCGTGGGACATGTGGATCTCTATAAGGGCACTGTTGATGGTATTTTAAAGATGTGGAAACATGAGGGCTTTTTTGCACTCTATAAAGGATTTTGGCCAAACTGGCTTCGGCTTGGACCCTGGAACATCATTTTTTTTATTACATACGAGCAGCTAAAGAGGCTTCAAATCTAA

Reference




    Data / case study


    Click to get more Data / Case study about the product.



    Associated products


    Category Cat No. Products Name
    Target Antibody GM-Tg-g-SE1440-Ab Anti-UCP5/ SLC25A14/ BMCP1 functional antibody
    Target Antigen GM-Tg-g-SE1440-Ag SLC25A14 protein
    ORF Viral Vector pGMLP003260 Human SLC25A14 Lentivirus plasmid
    ORF Viral Vector vGMLP003260 Human SLC25A14 Lentivirus particle


    Target information

    Target ID GM-SE1440
    Target Name SLC25A14
    Gene ID 9016, 20523, 703255, 85263, 101082985, 612910, 513415, 100054503
    Gene Symbol and Synonyms BMCP-1,BMCP1,SLC25A14,UCP5,UCP5L,UCP5S
    Uniprot Accession O95258
    Uniprot Entry Name UCP5_HUMAN
    Protein Sub-location Secreted Protein/Potential Cytokines
    Category Not Available
    Disease Not Available
    Gene Ensembl ENSG00000102078
    Target Classification Not Available

    Mitochondrial uncoupling proteins (UCP) are members of the larger family of mitochondrial anion carrier proteins (MACP). Uncoupling proteins separate oxidative phosphorylation from ATP synthesis with energy dissipated as heat, also referred to as the mitochondrial proton leak. Uncoupling proteins facilitate the transfer of anions from the inner to the outer mitochondrial membrane and the return transfer of protons from the outer to the inner mitochondrial membrane. They also reduce the mitochondrial membrane potential in mammalian cells. This gene is widely expressed in many tissues with the greatest abundance in brain and testis. Alternative splicing results in multiple transcript variants. A pseudogene of this gene has been defined on chromosome 4. [provided by RefSeq, Aug 2013]



    About GMVC

    GDU



    GMVC (GM Vector Core) is GeneMedi’s unique platform for QbD Viral vectors Processes development and manufacturing. In GMVC, our core expertise lies in the tailored production of viral vectors, including adeno-associated virus (AAV), lentivirus, and adenovirus. Our state-of-the-art facilities are equipped for scalable manufacturing, ensuring high-quality viral vector production to meet both research and therapeutic needs. Our expert team specializes in process development, leveraging innovative technology and extensive industry knowledge to provide clients with tailored solutions that exceed expectations. GMVC will be the ideal partner for scientists and healthcare professionals seeking reliable and efficient viral vector production services.