Human IKZF2/ANF1A2/ HELIOS ORF/cDNA clone-Lentivirus plasmid (NM_001079526)
Pre-made Human IKZF2/ANF1A2/ HELIOS Lentiviral expression plasmid for IKZF2 lentivirus packaging, IKZF2 lentivirus production, overexpression stable cell line development, cell transient transfection and gene delivery targeting T/B/NK cells, macrophages, cardiomyocytes, hepatocytes, and neurons.
Our GM-Lentiviral vector is seamlessly integrated with the GM lentivirus packaging system. Discover more about the GM lentivirus packaging system.
Go
to IKZF2/ANF1A2 products collection
>>
(antibodies,
antigen, VLP, mRNA, ORF viral vector, etc)
Product information
Catalog No. | Product Name | Plasmid Grade | Plasmid quantity |
---|---|---|---|
pGMLP003292 | Human IKZF2 Lentivirus plasmid | Research Grade | 10mg, 50mg, 100mg, 500mg, >1g |
GMP-like Grade | 10mg, 50mg, 100mg, 500mg, >1g | ||
High Quality (HQ) Grade | |||
Seed | 5ug |
Product Description
Catalog ID | pGMLP003292 |
Gene Name | IKZF2 |
Accession Number | NM_001079526 |
Gene ID | 22807 |
Species | Human |
Product Type | Lentivirus plasmid (overexpression) |
Insert Length | 1503 bp |
Gene Alias | ANF1A2, HELIOS, ZNF1A2, ZNFN1A2 |
Fluorescent Reporter | ZsGreen |
Mammalian Cell Selection | Puromyocin |
Fusion Tag | 3xflag (C-Terminal) |
Promoter | CMV |
Resistance | Amplicin |
Sequence | ATGGAAACAGAGGCTATTGATGGCTATATAACGTGTGACAATGAGCTTTCACCCGAAAGGGAGCACTCCAATATGGCAATTGACCTCACCTCAAGCACACCCAATGGACAGCATGCCTCACCAAGTCACATGACAAGCACAAATTCAGTAAAGCTAGAAATGCAGAGTGATGAAGAGTGTGACAGGAAACCCCTGAGCCGTGAAGATGAGATCAGGGGCCATGATGAGGGTAGCAGCCTAGAAGAACCCCTAATTGAGAGCAGCGAGGTGGCTGACAACAGGAAAGTCCAGGAGCTTCAAGGCGAGGGAGGAATCCGGCTTCCGAATGGTGAACGCCCCTTCCACTGTAACCAGTGTGGAGCTTCTTTTACTCAGAAGGGCAACCTTCTGAGACACATAAAGTTACACTCTGGAGAGAAGCCGTTCAAATGTCCTTTCTGTAGCTACGCCTGTAGAAGAAGGGACGCCCTCACAGGACACCTCAGGACCCATTCTGTGGGTAAACCTCACAAGTGCAACTACTGTGGACGAAGCTACAAGCAGCGCAGTTCACTGGAGGAGCACAAGGAACGCTGCCACAACTATCTCCAGAATGTCAGCATGGAGGCTGCTGGGCAGGTCATGAGTCACCATGTACCTCCTATGGAAGATTGTAAGGAACAAGAGCCTATTATGGACAACAATATTTCTCTGGTGCCTTTTGAGAGACCTGCTGTCATAGAGAAGCTCACGGGGAATATGGGAAAACGTAAAAGCTCCACTCCACAAAAGTTTGTGGGGGAAAAGCTCATGCGATTCAGCTACCCAGATATTCACTTTGATATGAACTTAACATATGAGAAGGAGGCTGAGCTGATGCAGTCTCATATGATGGACCAAGCCATCAACAATGCAATCACCTACCTTGGAGCTGAGGCCCTTCACCCTCTGATGCAGCACCCGCCAAGCACAATCGCTGAAGTGGCCCCAGTTATAAGCTCAGCTTATTCTCAGGTCTATCATCCAAATAGGATAGAAAGACCCATTAGCAGGGAAACTGCTGATAGTCATGAAAACAACATGGATGGCCCCATCTCTCTCATCAGACCAAAGAGTCGACCCCAGGAAAGAGAGGCCTCTCCCAGCAATAGCTGCCTGGATTCCACTGACTCAGAAAGCAGCCATGATGACCACCAGTCCTACCAAGGACACCCTGCCTTAAATCCCAAGAGGAAACAAAGCCCAGCTTACATGAAGGAGGATGTCAAAGCTTTGGATACTACCAAGGCTCCTAAGGGCTCTCTGAAGGACATCTACAAGGTCTTCAATGGAGAAGGAGAACAGATTAGGGCCTTCAAGTGTGAGCACTGCCGAGTCCTTTTCCTAGACCATGTCATGTACACCATTCACATGGGTTGCCATGGCTACCGGGACCCACTGGAATGCAACATCTGTGGCTACAGAAGCCAGGACCGTTATGAGTTTTCATCACACATTGTTCGAGGGGAGCACACATTCCACTAG |
Reference
Data / case study
Click to get more Data / Case study about the product.
Associated products
Category | Cat No. | Products Name |
---|---|---|
Target Antibody | GM-Tg-g-T81569-Ab | Anti-IKZF2 monoclonal antibody |
Target Antigen | GM-Tg-g-T81569-Ag | IKZF2 protein |
ORF Viral Vector | pGMLP003292 | Human IKZF2 Lentivirus plasmid |
ORF Viral Vector | pGMLP003993 | Human IKZF2 Lentivirus plasmid |
ORF Viral Vector | vGMLP003292 | Human IKZF2 Lentivirus particle |
ORF Viral Vector | vGMLP003993 | Human IKZF2 Lentivirus particle |
Target information
Target ID | GM-T81569 |
Target Name | IKZF2 |
Gene ID | 22807, 22779, 693521, 301476, 101100826, 488510, 786795 |
Gene Symbol and Synonyms | A730095J18Rik,ANF1A2,HELIOS,IKZF2,Zfpn1a2,ZNF1A2,ZNFN1A2 |
Uniprot Accession | Q9UKS7 |
Uniprot Entry Name | IKZF2_HUMAN |
Protein Sub-location | Introcelluar Protein |
Category | Therapeutics Target |
Disease | Not Available |
Gene Ensembl | ENSG00000030419 |
Target Classification | Not Available |
This gene encodes a member of the Ikaros family of zinc-finger proteins. Three members of this protein family (Ikaros, Aiolos and Helios) are hematopoietic-specific transcription factors involved in the regulation of lymphocyte development. This protein forms homo- or hetero-dimers with other Ikaros family members, and is thought to function predominantly in early hematopoietic development. Multiple transcript variants encoding different isoforms have been found for this gene, but the biological validity of some variants has not been determined. [provided by RefSeq, Jul 2008]
About GMVC
GMVC (GM Vector Core) is GeneMedi’s unique platform for QbD Viral vectors Processes development and manufacturing. In GMVC, our core expertise lies in the tailored production of viral vectors, including adeno-associated virus (AAV), lentivirus, and adenovirus. Our state-of-the-art facilities are equipped for scalable manufacturing, ensuring high-quality viral vector production to meet both research and therapeutic needs. Our expert team specializes in process development, leveraging innovative technology and extensive industry knowledge to provide clients with tailored solutions that exceed expectations. GMVC will be the ideal partner for scientists and healthcare professionals seeking reliable and efficient viral vector production services.