Human IKZF2/ANF1A2/ HELIOS ORF/cDNA clone-Lentivirus plasmid (NM_001079526)

Pre-made Human IKZF2/ANF1A2/ HELIOS Lentiviral expression plasmid for IKZF2 lentivirus packaging, IKZF2 lentivirus production, overexpression stable cell line development, cell transient transfection and gene delivery targeting T/B/NK cells, macrophages, cardiomyocytes, hepatocytes, and neurons.

Our GM-Lentiviral vector is seamlessly integrated with the GM lentivirus packaging system. Discover more about the GM lentivirus packaging system.

Target products collectionGo to IKZF2/ANF1A2 products collection >>
(antibodies, antigen, VLP, mRNA, ORF viral vector, etc)



Product information

Catalog No. Product Name Plasmid Grade Plasmid quantity
pGMLP003292 Human IKZF2 Lentivirus plasmid Research Grade 10mg, 50mg, 100mg, 500mg, >1g
GMP-like Grade 10mg, 50mg, 100mg, 500mg, >1g
High Quality (HQ) Grade
Seed 5ug


Product Description

Catalog ID pGMLP003292
Gene Name IKZF2
Accession Number NM_001079526
Gene ID 22807
Species Human
Product Type Lentivirus plasmid (overexpression)
Insert Length 1503 bp
Gene Alias ANF1A2, HELIOS, ZNF1A2, ZNFN1A2
Fluorescent Reporter ZsGreen
Mammalian Cell Selection Puromyocin
Fusion Tag 3xflag (C-Terminal)
Promoter CMV
Resistance Amplicin
Sequence ATGGAAACAGAGGCTATTGATGGCTATATAACGTGTGACAATGAGCTTTCACCCGAAAGGGAGCACTCCAATATGGCAATTGACCTCACCTCAAGCACACCCAATGGACAGCATGCCTCACCAAGTCACATGACAAGCACAAATTCAGTAAAGCTAGAAATGCAGAGTGATGAAGAGTGTGACAGGAAACCCCTGAGCCGTGAAGATGAGATCAGGGGCCATGATGAGGGTAGCAGCCTAGAAGAACCCCTAATTGAGAGCAGCGAGGTGGCTGACAACAGGAAAGTCCAGGAGCTTCAAGGCGAGGGAGGAATCCGGCTTCCGAATGGTGAACGCCCCTTCCACTGTAACCAGTGTGGAGCTTCTTTTACTCAGAAGGGCAACCTTCTGAGACACATAAAGTTACACTCTGGAGAGAAGCCGTTCAAATGTCCTTTCTGTAGCTACGCCTGTAGAAGAAGGGACGCCCTCACAGGACACCTCAGGACCCATTCTGTGGGTAAACCTCACAAGTGCAACTACTGTGGACGAAGCTACAAGCAGCGCAGTTCACTGGAGGAGCACAAGGAACGCTGCCACAACTATCTCCAGAATGTCAGCATGGAGGCTGCTGGGCAGGTCATGAGTCACCATGTACCTCCTATGGAAGATTGTAAGGAACAAGAGCCTATTATGGACAACAATATTTCTCTGGTGCCTTTTGAGAGACCTGCTGTCATAGAGAAGCTCACGGGGAATATGGGAAAACGTAAAAGCTCCACTCCACAAAAGTTTGTGGGGGAAAAGCTCATGCGATTCAGCTACCCAGATATTCACTTTGATATGAACTTAACATATGAGAAGGAGGCTGAGCTGATGCAGTCTCATATGATGGACCAAGCCATCAACAATGCAATCACCTACCTTGGAGCTGAGGCCCTTCACCCTCTGATGCAGCACCCGCCAAGCACAATCGCTGAAGTGGCCCCAGTTATAAGCTCAGCTTATTCTCAGGTCTATCATCCAAATAGGATAGAAAGACCCATTAGCAGGGAAACTGCTGATAGTCATGAAAACAACATGGATGGCCCCATCTCTCTCATCAGACCAAAGAGTCGACCCCAGGAAAGAGAGGCCTCTCCCAGCAATAGCTGCCTGGATTCCACTGACTCAGAAAGCAGCCATGATGACCACCAGTCCTACCAAGGACACCCTGCCTTAAATCCCAAGAGGAAACAAAGCCCAGCTTACATGAAGGAGGATGTCAAAGCTTTGGATACTACCAAGGCTCCTAAGGGCTCTCTGAAGGACATCTACAAGGTCTTCAATGGAGAAGGAGAACAGATTAGGGCCTTCAAGTGTGAGCACTGCCGAGTCCTTTTCCTAGACCATGTCATGTACACCATTCACATGGGTTGCCATGGCTACCGGGACCCACTGGAATGCAACATCTGTGGCTACAGAAGCCAGGACCGTTATGAGTTTTCATCACACATTGTTCGAGGGGAGCACACATTCCACTAG

Reference




    Data / case study


    Click to get more Data / Case study about the product.



    Associated products


    Category Cat No. Products Name
    Target Antibody GM-Tg-g-T81569-Ab Anti-IKZF2 monoclonal antibody
    Target Antigen GM-Tg-g-T81569-Ag IKZF2 protein
    ORF Viral Vector pGMLP003292 Human IKZF2 Lentivirus plasmid
    ORF Viral Vector pGMLP003993 Human IKZF2 Lentivirus plasmid
    ORF Viral Vector vGMLP003292 Human IKZF2 Lentivirus particle
    ORF Viral Vector vGMLP003993 Human IKZF2 Lentivirus particle


    Target information

    Target ID GM-T81569
    Target Name IKZF2
    Gene ID 22807, 22779, 693521, 301476, 101100826, 488510, 786795
    Gene Symbol and Synonyms A730095J18Rik,ANF1A2,HELIOS,IKZF2,Zfpn1a2,ZNF1A2,ZNFN1A2
    Uniprot Accession Q9UKS7
    Uniprot Entry Name IKZF2_HUMAN
    Protein Sub-location Introcelluar Protein
    Category Therapeutics Target
    Disease Not Available
    Gene Ensembl ENSG00000030419
    Target Classification Not Available

    This gene encodes a member of the Ikaros family of zinc-finger proteins. Three members of this protein family (Ikaros, Aiolos and Helios) are hematopoietic-specific transcription factors involved in the regulation of lymphocyte development. This protein forms homo- or hetero-dimers with other Ikaros family members, and is thought to function predominantly in early hematopoietic development. Multiple transcript variants encoding different isoforms have been found for this gene, but the biological validity of some variants has not been determined. [provided by RefSeq, Jul 2008]



    About GMVC

    GDU



    GMVC (GM Vector Core) is GeneMedi’s unique platform for QbD Viral vectors Processes development and manufacturing. In GMVC, our core expertise lies in the tailored production of viral vectors, including adeno-associated virus (AAV), lentivirus, and adenovirus. Our state-of-the-art facilities are equipped for scalable manufacturing, ensuring high-quality viral vector production to meet both research and therapeutic needs. Our expert team specializes in process development, leveraging innovative technology and extensive industry knowledge to provide clients with tailored solutions that exceed expectations. GMVC will be the ideal partner for scientists and healthcare professionals seeking reliable and efficient viral vector production services.