Human MSR1/CD204/phSR1 ORF/cDNA clone-Lentivirus plasmid (NM_002445)

Cat. No.: pGMLP003293
Size: 10 µg
Concentration: generally 0.5ug/ul, usually not less than 0.3ug/ul
Leading Time: 3-7 working days

Pre-made Human MSR1/CD204/phSR1 Lentiviral expression plasmid for MSR1 lentivirus packaging, MSR1 lentivirus production, overexpression stable cell line development, cell transient transfection and gene delivery targeting T/B/NK cells, macrophages, cardiomyocytes, hepatocytes, and neurons.

Our GM-Lentiviral vector is seamlessly integrated with the GM lentivirus packaging system. Discover more about the GM lentivirus packaging system.

pdf Datasheet
pdf MSDS
pdf Terms of Use
Target products collection

Go to MSR1/CD204 products collection>>
(antibodies, antigen, VLP, mRNA, ORF viral vector, etc)

Purchase
Total Price: $601.56
Shipping fee: Limited-time free
For payment issues, contact us.


Product Description

Catalog ID pGMLP003293
Gene Name MSR1
Accession Number NM_002445
Gene ID 4481
Species Human
Product Type Lentivirus plasmid (overexpression)
Insert Length 1077 bp
Gene Alias CD204,phSR1,phSR2,SCARA1,SR-A,SR-AI,SR-AII,SR-AIII,SRA
Fluorescent Reporter ZsGreen
Mammalian Cell Selection Puromyocin
Fusion Tag 3xflag (C-Terminal)
Promoter CMV
Resistance Amplicin
ORF Nucleotide Sequence ATGGAGCAGTGGGATCACTTTCACAATCAACAGGAGGACACTGATAGCTGCTCCGAATCTGTGAAATTTGATGCTCGCTCAATGACAGCTTTGCTTCCTCCGAATCCTAAAAACAGCCCTTCCCTTCAAGAGAAACTGAAGTCCTTCAAAGCTGCACTGATTGCCCTTTACCTCCTCGTGTTTGCAGTTCTCATCCCTCTCATTGGAATAGTGGCAGCTCAACTCCTGAAGTGGGAAACGAAGAATTGCTCAGTTAGTTCAACTAATGCAAATGATATAACTCAAAGTCTCACGGGAAAAGGAAATGACAGCGAAGAGGAAATGAGATTTCAAGAAGTCTTTATGGAACACATGAGCAACATGGAGAAGAGAATCCAGCATATTTTAGACATGGAAGCCAACCTCATGGACACAGAGCATTTCCAAAATTTCAGCATGACAACTGATCAAAGATTTAATGACATTCTTCTGCAGCTAAGTACCTTGTTTTCCTCAGTCCAGGGACATGGGAATGCAATAGATGAAATCTCCAAGTCCTTAATAAGTTTGAATACCACATTGCTTGATTTGCAGCTCAACATAGAAAATCTGAATGGCAAAATCCAAGAGAATACCTTCAAACAACAAGAGGAAATCAGTAAATTAGAGGAGCGTGTTTACAATGTATCAGCAGAAATTATGGCTATGAAAGAAGAACAAGTGCATTTGGAACAGGAAATAAAAGGAGAAGTGAAAGTACTGAATAACATCACTAATGATCTCAGACTGAAAGATTGGGAACATTCTCAGACCTTGAGAAATATCACTTTAATTCAAGGTCCTCCTGGACCCCCGGGTGAAAAAGGAGATCGAGGTCCCACTGGAGAAAGTGGTCCACGAGGATTTCCAGGTCCAATAGGTCCTCCGGGTCTTAAAGGTGATCGGGGAGCAATTGGCTTTCCTGGAAGTCGAGGACTCCCAGGATATGCCGGAAGGCCAGGAAATTCTGGACCAAAAGGCCAGAAAGGGGAAAAGGGGAGTGGAAACACATTAAGACCAGTACAACTCACTGATCATATTAGGGCAGGGCCCTCTTAA
ORF Protein Sequence MEQWDHFHNQQEDTDSCSESVKFDARSMTALLPPNPKNSPSLQEKLKSFKAALIALYLLVFAVLIPLIGIVAAQLLKWETKNCSVSSTNANDITQSLTGKGNDSEEEMRFQEVFMEHMSNMEKRIQHILDMEANLMDTEHFQNFSMTTDQRFNDILLQLSTLFSSVQGHGNAIDEISKSLISLNTTLLDLQLNIENLNGKIQENTFKQQEEISKLEERVYNVSAEIMAMKEEQVHLEQEIKGEVKVLNNITNDLRLKDWEHSQTLRNITLIQGPPGPPGEKGDRGPTGESGPRGFPGPIGPPGLKGDRGAIGFPGSRGLPGYAGRPGNSGPKGQKGEKGSGNTLRPVQLTDHIRAGPS

Reference




    Data / case study


    Click to get more Data / Case study about the product.



    Associated products


    Category Cat No. Products Name
    Target Antibody GM-Tg-g-T50007-Ab Anti-MSRE/ MSR1/ CD204 monoclonal antibody
    Target Antigen GM-Tg-g-T50007-Ag MSR1 VLP (virus-like particle)
    ORF Viral Vector pGMLP003293 Human MSR1 Lentivirus plasmid
    ORF Viral Vector vGMLP003293 Human MSR1 Lentivirus particle


    Target information

    Target ID GM-T50007
    Target Name MSR1
    Gene ID 4481, 20288, 709365, 498638, 101081290, 482891, 281311, 100053116
    Gene Symbol and Synonyms CD204,MRS-A,MSR,MSR-A,MSR1,phSR1,phSR2,RGD1564316,SCARA1,Scvr,SR-A,SR-AI,SR-AII,SR-AIII,SRA
    Uniprot Accession P21757
    Uniprot Entry Name MSRE_HUMAN
    Protein Sub-location Transmembrane Protein
    Category Therapeutics Target
    Disease Cancer
    Gene Ensembl ENSG00000038945
    Target Classification Tumor-associated antigen (TAA)

    This gene encodes the class A macrophage scavenger receptors, which include three different types (1, 2, 3) generated by alternative splicing of this gene. These receptors or isoforms are macrophage-specific trimeric integral membrane glycoproteins and have been implicated in many macrophage-associated physiological and pathological processes including atherosclerosis, Alzheimer's disease, and host defense. The isoforms type 1 and type 2 are functional receptors and are able to mediate the endocytosis of modified low density lipoproteins (LDLs). The isoform type 3 does not internalize modified LDL (acetyl-LDL) despite having the domain shown to mediate this function in the types 1 and 2 isoforms. It has an altered intracellular processing and is trapped within the endoplasmic reticulum, making it unable to perform endocytosis. The isoform type 3 can inhibit the function of isoforms type 1 and type 2 when co-expressed, indicating a dominant negative effect and suggesting a mechanism for regulation of scavenger receptor activity in macrophages. [provided by RefSeq, Jul 2008]



    About GMVC

    GDU

    GMVC (GM Vector Core) is GeneMedi’s unique platform for QbD Viral vectors Processes development and manufacturing. In GMVC, our core expertise lies in the tailored production of viral vectors, including adeno-associated virus (AAV), lentivirus, and adenovirus. Our state-of-the-art facilities are equipped for scalable manufacturing, ensuring high-quality viral vector production to meet both research and therapeutic needs. Our expert team specializes in process development, leveraging innovative technology and extensive industry knowledge to provide clients with tailored solutions that exceed expectations. GMVC will be the ideal partner for scientists and healthcare professionals seeking reliable and efficient viral vector production services.