- • Up to 20%-50%* off first purchase
- • Bulk quantities available
- • Citation Reward application
Sample Application
- • Animal health test
- • In-vitro diagnostics
- • Food & Feed Safety
- • Environmental Safety
- • New drug discovery
Supports
- Talk to our Expert:
[email protected] -
Talk to our sales:
[email protected]
Protocol Library Download
 |
 |
Human TXNRD1/GRIM-12/ TR ORF/cDNA clone-Lentivirus plasmid (NM_182743)
Pre-made Human TXNRD1/GRIM-12/ TR Lentiviral expression plasmid for TXNRD1 lentivirus packaging, TXNRD1 lentivirus production, overexpression stable cell line development, cell transient transfection and gene delivery targeting T/B/NK cells, macrophages, cardiomyocytes, hepatocytes, and neurons.
Our GM-Lentiviral vector is seamlessly integrated with the GM lentivirus packaging system. Discover more about the GM lentivirus packaging system.
Go
to TXNRD1/GRIM-12 products collection
>>
(antibodies,
antigen, VLP, mRNA, ORF viral vector, etc)
Product information
| Catalog No. | Product Name | Plasmid Grade | Plasmid quantity |
|---|---|---|---|
| pGMLP003303 | Human TXNRD1 Lentivirus plasmid | Research Grade | 10mg, 50mg, 100mg, 500mg, >1g |
| GMP-like Grade | 10mg, 50mg, 100mg, 500mg, >1g | ||
| High Quality (HQ) Grade | |||
| Seed | 5ug |
Product Description
| Catalog ID | pGMLP003303 |
| Gene Name | TXNRD1 |
| Accession Number | NM_182743 |
| Gene ID | 7296 |
| Species | Human |
| Product Type | Lentivirus plasmid (overexpression) |
| Insert Length | 1500 bp |
| Gene Alias | GRIM-12, TR, TR1, TRXR1, TXNR |
| Fluorescent Reporter | ZsGreen |
| Mammalian Cell Selection | Puromyocin |
| Fusion Tag | 3xflag (C-Terminal) |
| Promoter | CMV |
| Resistance | Amplicin |
| Sequence | ATGAACGGCCCTGAAGATCTTCCCAAGTCCTATGACTATGACCTTATCATCATTGGAGGTGGCTCAGGAGGTCTGGCAGCTGCTAAGGAGGCAGCCCAATATGGCAAGAAGGTGATGGTCCTGGACTTTGTCACTCCCACCCCTCTTGGAACTAGATGGGGTCTCGGAGGAACATGTGTGAATGTGGGTTGCATACCTAAAAAACTGATGCATCAAGCAGCTTTGTTAGGACAAGCCCTGCAAGACTCTCGAAATTATGGATGGAAAGTCGAGGAGACAGTTAAGCATGATTGGGACAGAATGATAGAAGCTGTACAGAATCACATTGGCTCTTTGAATTGGGGCTACCGAGTAGCTCTGCGGGAGAAAAAAGTCGTCTATGAGAATGCTTATGGGCAATTTATTGGTCCTCACAGGATTAAGGCAACAAATAATAAAGGCAAAGAAAAAATTTATTCAGCAGAGAGATTTCTCATTGCCACTGGTGAAAGACCACGTTACTTGGGCATCCCTGGTGACAAAGAATACTGCATCAGCAGTGATGATCTTTTCTCCTTGCCTTACTGCCCGGGTAAGACCCTGGTTGTTGGAGCATCCTATGTCGCTTTGGAGTGCGCTGGATTTCTTGCTGGTATTGGTTTAGACGTCACTGTTATGGTTAGGTCCATTCTTCTTAGAGGATTTGACCAGGACATGGCCAACAAAATTGGTGAACACATGGAAGAACATGGCATCAAGTTTATAAGACAGTTCGTACCAATTAAAGTTGAACAAATTGAAGCAGGGACACCAGGCCGACTCAGAGTAGTAGCTCAGTCCACCAATAGTGAGGAAATCATTGAAGGAGAATATAATACGGTGATGCTGGCAATAGGAAGAGATGCTTGCACAAGAAAAATTGGCTTAGAAACCGTAGGGGTGAAGATAAATGAAAAGACTGGAAAAATACCTGTCACAGATGAAGAACAGACCAATGTGCCTTACATCTATGCCATTGGCGATATATTGGAGGATAAGGTGGAGCTCACCCCAGTTGCAATCCAGGCAGGAAGATTGCTGGCTCAGAGGCTCTATGCAGGTTCCACTGTCAAGTGTGACTATGAAAATGTTCCAACCACTGTATTTACTCCTTTGGAATATGGTGCTTGTGGCCTTTCTGAGGAGAAAGCTGTGGAGAAGTTTGGGGAAGAAAATATTGAGGTTTACCATAGTTACTTTTGGCCATTGGAATGGACGATTCCGTCAAGAGATAACAACAAATGTTATGCAAAAATAATCTGTAATACTAAAGACAATGAACGTGTTGTGGGCTTTCACGTACTGGGTCCAAATGCTGGAGAAGTTACACAAGGCTTTGCAGCTGCGCTCAAATGTGGACTGACCAAAAAGCAGCTGGACAGCACAATTGGAATCCACCCTGTCTGTGCAGAGGTATTCACAACATTGTCTGTGACCAAGCGCTCTGGGGCAAGCATCCTCCAGGCTGGCTGCTGAGGTTAA |
Reference
Data / case study
Click to get more Data / Case study about the product.
Associated products
| Category | Cat No. | Products Name |
|---|---|---|
| Target Antibody | GM-Tg-g-T84581-Ab | Anti-TXNRD1 monoclonal antibody |
| Target Antigen | GM-Tg-g-T84581-Ag | TXNRD1 protein |
| ORF Viral Vector | pGMLP003303 | Human TXNRD1 Lentivirus plasmid |
| ORF Viral Vector | vGMLP003303 | Human TXNRD1 Lentivirus particle |
Target information
| Target ID | GM-T84581 |
| Target Name | TXNRD1 |
| Gene ID | 7296, 50493, 701062, 58819, 101085222, 474536, 282388 |
| Gene Symbol and Synonyms | GRIM-12,TR,TR1,TRXR1,TXNR,TXNRD1 |
| Uniprot Accession | Q16881 |
| Uniprot Entry Name | TRXR1_HUMAN |
| Protein Sub-location | Introcelluar Protein |
| Category | Therapeutics Target, Diagnostics Biomarker |
| Disease | Malignant neoplasm of bladder, IgA glomerulonephritis, leukemia |
| Gene Ensembl | ENSG00000198431 |
| Target Classification | Not Available |
The protein encoded by this gene belongs to the pyridine nucleotide-disulfide oxidoreductase family, and is a member of the thioredoxin (Trx) system. Three thioredoxin reductase (TrxR) isozymes are found in mammals. TrxRs are selenocysteine-containing flavoenzymes, which reduce thioredoxins, as well as other substrates, and play a key role in redox homoeostasis. This gene encodes an ubiquitously expressed, cytosolic form of TrxR, which functions as a homodimer containing FAD, and selenocysteine (Sec) at the active site. Sec is encoded by UGA codon that normally signals translation termination. The 3' UTRs of selenoprotein mRNAs contain a conserved stem-loop structure, the Sec insertion sequence (SECIS) element, which is necessary for the recognition of UGA as a Sec codon rather than as a stop signal. Alternative splicing, primarily at the 5' end, results in transcript variants encoding same or different isoforms, including a glutaredoxin-containing isoform that is predominantly expressed in testis. [provided by RefSeq, May 2017]
About GMVC
GMVC (GM Vector Core) is GeneMedi’s unique platform for QbD Viral vectors Processes development and manufacturing. In GMVC, our core expertise lies in the tailored production of viral vectors, including adeno-associated virus (AAV), lentivirus, and adenovirus. Our state-of-the-art facilities are equipped for scalable manufacturing, ensuring high-quality viral vector production to meet both research and therapeutic needs. Our expert team specializes in process development, leveraging innovative technology and extensive industry knowledge to provide clients with tailored solutions that exceed expectations. GMVC will be the ideal partner for scientists and healthcare professionals seeking reliable and efficient viral vector production services.
Facebook
LinkedIn
Twitter
