Human GPX4/GPx-4/ GSHPx-4 ORF/cDNA clone-Lentivirus plasmid (NM_002085)

Product information

Catalog No.	Product Name	Plasmid Grade	Plasmid quantity
pGMLP003326	Human GPX4 Lentivirus plasmid	Research Grade	10mg, 50mg, 100mg, 500mg, >1g
		GMP-like Grade	10mg, 50mg, 100mg, 500mg, >1g
		High Quality (HQ) Grade
		Seed	5ug

Product Description

Catalog ID	pGMLP003326
Gene Name	GPX4
Accession Number	NM_002085
Gene ID	2879
Species	Human
Product Type	Lentivirus plasmid (overexpression)
Insert Length	594 bp
Gene Alias	GPx-4, GSHPx-4, MCSP, PHGPx, SMDS, snGPx, snPHGPx
Fluorescent Reporter	ZsGreen
Mammalian Cell Selection	Puromyocin
Fusion Tag	3xflag (C-Terminal)
Promoter	CMV
Resistance	Amplicin
Sequence	ATGAGCCTCGGCCGCCTTTGCCGCCTACTGAAGCCGGCGCTGCTCTGTGGGGCTCTGGCCGCGCCTGGCCTGGCCGGGACCATGTGCGCGTCCCGGGACGACTGGCGCTGTGCGCGCTCCATGCACGAGTTTTCCGCCAAGGACATCGACGGGCACATGGTTAACCTGGACAAGTACCGGGGCTTCGTGTGCATCGTCACCAACGTGGCCTCCCAGTGAGGCAAGACCGAAGTAAACTACACTCAGCTCGTCGACCTGCACGCCCGATACGCTGAGTGTGGTTTGCGGATCCTGGCCTTCCCGTGTAACCAGTTCGGGAAGCAGGAGCCAGGGAGTAACGAAGAGATCAAAGAGTTCGCCGCGGGCTACAACGTCAAATTCGATATGTTCAGCAAGATCTGCGTGAACGGGGACGACGCCCACCCGCTGTGGAAGTGGATGAAGATCCAACCCAAGGGCAAGGGCATCCTGGGAAATGCCATCAAGTGGAACTTCACCAAGTTCCTCATCGACAAGAACGGCTGCGTGGTGAAGCGCTACGGACCCATGGAGGAGCCCCTGGTGATAGAGAAGGACCTGCCCCACTATTTCTAG

Reference

Data / case study

Click to get more Data / Case study about the product.

Associated products

Category	Cat No.	Products Name
Target Antibody	GM-Tg-g-SE1581-Ab	Anti-GPX4/ GPx-4/ GSHPx-4 functional antibody
Target Antigen	GM-Tg-g-SE1581-Ag	GPX4 protein
ORF Viral Vector	pGMLV000936	Rat Gpx4 Lentivirus plasmid
ORF Viral Vector	pGMLV001745	Human GPX4 Lentivirus plasmid
ORF Viral Vector	pGMPC000647	Human GPX4 Mammalian (Non-Viral Vector) plasmid
ORF Viral Vector	pGMLP003326	Human GPX4 Lentivirus plasmid
ORF Viral Vector	vGMLV000936	Rat Gpx4 Lentivirus particle
ORF Viral Vector	vGMLV001745	Human GPX4 Lentivirus particle
ORF Viral Vector	vGMLP003326	Human GPX4 Lentivirus particle

Target information

Target ID	GM-SE1581
Target Name	GPX4
Gene ID	2879, 625249, 705333, 29328, 101095956, 119864793, 286809, 102147383
Gene Symbol and Synonyms	GPx-4,GPX4,GSHPx-4,MCSP,mtPHGPx,PHGPx,SMDS,snGPx,snPHGPx
Uniprot Accession	P36969
Uniprot Entry Name	GPX4_HUMAN
Protein Sub-location	Secreted Protein/Potential Cytokines
Category	Not Available
Disease	Not Available
Gene Ensembl	ENSG00000167468
Target Classification	Not Available

The protein encoded by this gene belongs to the glutathione peroxidase family, members of which catalyze the reduction of hydrogen peroxide, organic hydroperoxides and lipid hydroperoxides, and thereby protect cells against oxidative damage. Several isozymes of this gene family exist in vertebrates, which vary in cellular location and substrate specificity. This isozyme has a high preference for lipid hydroperoxides and protects cells against membrane lipid peroxidation and cell death. It is also required for normal sperm development; thus, it has been identified as a 'moonlighting' protein because of its ability to serve dual functions as a peroxidase, as well as a structural protein in mature spermatozoa. Mutations in this gene are associated with Sedaghatian type of spondylometaphyseal dysplasia (SMDS). This isozyme is also a selenoprotein, containing the rare amino acid selenocysteine (Sec) at its active site. Sec is encoded by the UGA codon, which normally signals translation termination. The 3' UTRs of selenoprotein mRNAs contain a conserved stem-loop structure, designated the Sec insertion sequence (SECIS) element, that is necessary for the recognition of UGA as a Sec codon, rather than as a stop signal. Transcript variants resulting from alternative splicing or use of alternate promoters have been described to encode isoforms with different subcellular localization. [provided by RefSeq, Dec 2018]

About GMVC