Human GPX4/GPx-4/ GSHPx-4 ORF/cDNA clone-Lentivirus plasmid (NM_002085.5)
Pre-made Human GPX4/GPx-4/ GSHPx-4 Lentiviral expression plasmid for GPX4 lentivirus packaging, GPX4 lentivirus production, overexpression stable cell line development, cell transient transfection and gene delivery targeting T/B/NK cells, macrophages, cardiomyocytes, hepatocytes, and neurons.
Our GM-Lentiviral vector is seamlessly integrated with the GM lentivirus packaging system. Discover more about the GM lentivirus packaging system.
Go
to GPX4/GPx-4 products collection
>>
(antibodies,
antigen, VLP, mRNA, ORF viral vector, etc)
Product information
Catalog No. | Product Name | Plasmid Grade | Plasmid quantity |
---|---|---|---|
pGMLV001745 | Human GPX4 Lentivirus plasmid | Research Grade | 10mg, 50mg, 100mg, 500mg, >1g |
GMP-like Grade | 10mg, 50mg, 100mg, 500mg, >1g | ||
High Quality (HQ) Grade | |||
Seed | 5ug |
Product Description
Catalog ID | pGMLV001745 |
Gene Name | GPX4 |
Accession Number | NM_002085.5 |
Gene ID | 2879 |
Species | Human |
Product Type | Lentivirus plasmid (overexpression) |
Insert Length | 594 bp |
Gene Alias | GPx-4, GSHPx-4, MCSP, PHGPx, SMDS, snGPx, snPHGPx |
Fluorescent Reporter | ZsGreen |
Mammalian Cell Selection | Puromyocinmyocin |
Fusion Tag | 3xflag (C-Terminal) |
Promoter | CMV |
Resistance | Amplicin |
Sequence | ATGAGCCTCGGCCGCCTTTGCCGCCTACTGAAGCCGGCGCTGCTCTGTGGGGCTCTGGCCGCGCCTGGCCTGGCCGGGACCATGTGCGCGTCCCGGGACGACTGGCGCTGTGCGCGCTCCATGCACGAGTTTTCCGCCAAGGACATCGACGGGCACATGGTTAACCTGGACAAGTACCGGGGCTTCGTGTGCATCGTCACCAACGTGGCCTCCCAGTGAGGCAAGACCGAAGTAAACTACACTCAGCTCGTCGACCTGCACGCCCGATACGCTGAGTGTGGTTTGCGGATCCTGGCCTTCCCGTGTAACCAGTTCGGGAAGCAGGAGCCAGGGAGTAACGAAGAGATCAAAGAGTTCGCCGCGGGCTACAACGTCAAATTCGATATGTTCAGCAAGATCTGCGTGAACGGGGACGACGCCCACCCGCTGTGGAAGTGGATGAAGATCCAACCCAAGGGCAAGGGCATCCTGGGAAATGCCATCAAGTGGAACTTCACCAAGTTCCTCATCGACAAGAACGGCTGCGTGGTGAAGCGCTACGGACCCATGGAGGAGCCCCTGGTGATAGAGAAGGACCTGCCCCACTATTTCTAG |
Reference
Data / case study
Click to get more Data / Case study about the product.
Associated products
Category | Cat No. | Products Name |
---|---|---|
Target Antibody | GM-Tg-g-SE1581-Ab | Anti-GPX4/ GPx-4/ GSHPx-4 functional antibody |
Target Antigen | GM-Tg-g-SE1581-Ag | GPX4 protein |
ORF Viral Vector | pGMLV000936 | Rat Gpx4 Lentivirus plasmid |
ORF Viral Vector | pGMLV001745 | Human GPX4 Lentivirus plasmid |
ORF Viral Vector | pGMPC000647 | Human GPX4 Mammalian (Non-Viral Vector) plasmid |
ORF Viral Vector | pGMLP003326 | Human GPX4 Lentivirus plasmid |
ORF Viral Vector | vGMLV000936 | Rat Gpx4 Lentivirus particle |
ORF Viral Vector | vGMLV001745 | Human GPX4 Lentivirus particle |
ORF Viral Vector | vGMLP003326 | Human GPX4 Lentivirus particle |
Target information
Target ID | GM-SE1581 |
Target Name | GPX4 |
Gene ID | 2879, 625249, 705333, 29328, 101095956, 119864793, 286809, 102147383 |
Gene Symbol and Synonyms | GPx-4,GPX4,GSHPx-4,MCSP,mtPHGPx,PHGPx,SMDS,snGPx,snPHGPx |
Uniprot Accession | P36969 |
Uniprot Entry Name | GPX4_HUMAN |
Protein Sub-location | Secreted Protein/Potential Cytokines |
Category | Not Available |
Disease | Not Available |
Gene Ensembl | ENSG00000167468 |
Target Classification | Not Available |
The protein encoded by this gene belongs to the glutathione peroxidase family, members of which catalyze the reduction of hydrogen peroxide, organic hydroperoxides and lipid hydroperoxides, and thereby protect cells against oxidative damage. Several isozymes of this gene family exist in vertebrates, which vary in cellular location and substrate specificity. This isozyme has a high preference for lipid hydroperoxides and protects cells against membrane lipid peroxidation and cell death. It is also required for normal sperm development; thus, it has been identified as a 'moonlighting' protein because of its ability to serve dual functions as a peroxidase, as well as a structural protein in mature spermatozoa. Mutations in this gene are associated with Sedaghatian type of spondylometaphyseal dysplasia (SMDS). This isozyme is also a selenoprotein, containing the rare amino acid selenocysteine (Sec) at its active site. Sec is encoded by the UGA codon, which normally signals translation termination. The 3' UTRs of selenoprotein mRNAs contain a conserved stem-loop structure, designated the Sec insertion sequence (SECIS) element, that is necessary for the recognition of UGA as a Sec codon, rather than as a stop signal. Transcript variants resulting from alternative splicing or use of alternate promoters have been described to encode isoforms with different subcellular localization. [provided by RefSeq, Dec 2018]
About GMVC
GMVC (GM Vector Core) is GeneMedi’s unique platform for QbD Viral vectors Processes development and manufacturing. In GMVC, our core expertise lies in the tailored production of viral vectors, including adeno-associated virus (AAV), lentivirus, and adenovirus. Our state-of-the-art facilities are equipped for scalable manufacturing, ensuring high-quality viral vector production to meet both research and therapeutic needs. Our expert team specializes in process development, leveraging innovative technology and extensive industry knowledge to provide clients with tailored solutions that exceed expectations. GMVC will be the ideal partner for scientists and healthcare professionals seeking reliable and efficient viral vector production services.