Human OPRL1/KOR-3/NOCIR ORF/cDNA clone-Lentivirus plasmid (NM_001200019)

Cat. No.: pGMLP003330
Size: 10 µg
Concentration: generally 0.5ug/ul, usually not less than 0.3ug/ul
Leading Time: 3-7 working days

Pre-made Human OPRL1/KOR-3/NOCIR Lentiviral expression plasmid for OPRL1 lentivirus packaging, OPRL1 lentivirus production, overexpression stable cell line development, cell transient transfection and gene delivery targeting T/B/NK cells, macrophages, cardiomyocytes, hepatocytes, and neurons.

Our GM-Lentiviral vector is seamlessly integrated with the GM lentivirus packaging system. Discover more about the GM lentivirus packaging system.

pdf Datasheet
pdf MSDS
pdf Terms of Use
Target products collection

Go to OPRL1/KOR-3 products collection>>
(antibodies, antigen, VLP, mRNA, ORF viral vector, etc)

Purchase
Total Price: $611.64
Shipping fee: Limited-time free
For payment issues, contact us.


Product Description

Catalog ID pGMLP003330
Gene Name OPRL1
Accession Number NM_001200019
Gene ID 4987
Species Human
Product Type Lentivirus plasmid (overexpression)
Insert Length 1113 bp
Gene Alias KOR-3,NOCIR,NOP,NOPr,OOR,ORL1
Fluorescent Reporter ZsGreen
Mammalian Cell Selection Puromyocin
Fusion Tag 3xflag (C-Terminal)
Promoter CMV
Resistance Amplicin
ORF Nucleotide Sequence ATGGAGCCCCTCTTCCCCGCGCCGTTCTGGGAGGTTATCTACGGCAGCCACCTTCAGGGCAACCTGTCCCTCCTGAGCCCCAACCACAGTCTGCTGCCCCCGCATCTGCTGCTCAATGCCAGCCACGGCGCCTTCCTGCCCCTCGGGCTCAAGGTCACCATCGTGGGGCTCTACCTGGCCGTGTGTGTCGGAGGGCTCCTGGGGAACTGCCTTGTCATGTACGTCATCCTCAGGCACACCAAAATGAAGACAGCCACCAATATTTACATCTTTAACCTGGCCCTGGCCGACACTCTGGTCCTGCTGACGCTGCCCTTCCAGGGCACGGACATCCTCCTGGGCTTCTGGCCGTTTGGGAATGCGCTGTGCAAGACAGTCATTGCCATTGACTACTACAACATGTTCACCAGCACCTTCACCCTAACTGCCATGAGTGTGGATCGCTATGTAGCCATCTGCCACCCCATCCGTGCCCTCGACGTCCGCACGTCCAGCAAAGCCCAGGCTGTCAATGTGGCCATCTGGGCCCTGGCCTCTGTTGTCGGTGTTCCCGTTGCCATCATGGGCTCGGCACAGGTCGAGGATGAAGAGATCGAGTGCCTGGTGGAGATCCCTACCCCTCAGGATTACTGGGGCCCGGTGTTTGCCATCTGCATCTTCCTCTTCTCCTTCATCGTCCCCGTGCTCGTCATCTCTGTCTGCTACAGCCTCATGATCCGGCGGCTCCGTGGAGTCCGCCTGCTCTCGGGCTCCCGAGAGAAGGACCGGAACCTGCGGCGCATCACTCGGCTGGTGCTGGTGGTAGTGGCTGTGTTCGTGGGCTGCTGGACGCCTGTCCAGGTCTTCGTGCTGGCCCAAGGGCTGGGGGTTCAGCCGAGCAGCGAGACTGCCGTGGCCATTCTGCGCTTCTGCACGGCCCTGGGCTACGTCAACAGCTGCCTCAACCCCATCCTCTACGCCTTCCTGGATGAGAACTTCAAGGCCTGCTTCCGCAAGTTCTGCTGTGCATCTGCCCTGCGCCGGGACGTGCAGGTGTCTGACCGCGTGCGCAGCATTGCCAAGGACGTGGCCCTGGCCTGCAAGACCTCTGAGACGGTACCGCGGCCCGCATGA
ORF Protein Sequence MEPLFPAPFWEVIYGSHLQGNLSLLSPNHSLLPPHLLLNASHGAFLPLGLKVTIVGLYLAVCVGGLLGNCLVMYVILRHTKMKTATNIYIFNLALADTLVLLTLPFQGTDILLGFWPFGNALCKTVIAIDYYNMFTSTFTLTAMSVDRYVAICHPIRALDVRTSSKAQAVNVAIWALASVVGVPVAIMGSAQVEDEEIECLVEIPTPQDYWGPVFAICIFLFSFIVPVLVISVCYSLMIRRLRGVRLLSGSREKDRNLRRITRLVLVVVAVFVGCWTPVQVFVLAQGLGVQPSSETAVAILRFCTALGYVNSCLNPILYAFLDENFKACFRKFCCASALRRDVQVSDRVRSIAKDVALACKTSETVPRPA

Reference




    Data / case study


    Click to get more Data / Case study about the product.



    Associated products


    Category Cat No. Products Name
    Target Antibody GM-Tg-g-T52921-Ab Anti-OPRX/ OPRL1/ KOR-3 monoclonal antibody
    Target Antigen GM-Tg-g-T52921-Ag OPRL1 VLP (virus-like particle)
    ORF Viral Vector pGMLP003330 Human OPRL1 Lentivirus plasmid
    ORF Viral Vector vGMLP003330 Human OPRL1 Lentivirus particle


    Target information

    Target ID GM-T52921
    Target Name OPRL1
    Gene ID 4987, 18389, 719224, 29256, 101090851, 485985, 100296381, 100051762
    Gene Symbol and Synonyms KOR-3,KOR3,LC132,MOR-C,morc,NOCIR,NOP,NOPr,OFQR,OOR,OPRL,OPRL1,ORGC,ORL1,PNOCR,XOR1
    Uniprot Accession P41146
    Uniprot Entry Name OPRX_HUMAN
    Protein Sub-location Transmembrane Protein
    Category Therapeutics Target
    Disease Not Available
    Gene Ensembl ENSG00000125510
    Target Classification GPCR

    The protein encoded by this gene is a member of the 7 transmembrane-spanning G protein-coupled receptor family, and functions as a receptor for the endogenous, opioid-related neuropeptide, nociceptin/orphanin FQ. This receptor-ligand system modulates a variety of biological functions and neurobehavior, including stress responses and anxiety behavior, learning and memory, locomotor activity, and inflammatory and immune responses. A promoter region between this gene and the 5'-adjacent RGS19 (regulator of G-protein signaling 19) gene on the opposite strand functions bi-directionally as a core-promoter for both genes, suggesting co-operative transcriptional regulation of these two functionally related genes. Alternatively spliced transcript variants have been described for this gene. A recent study provided evidence for translational readthrough in this gene, and expression of an additional C-terminally extended isoform via the use of an alternative in-frame translation termination codon. [provided by RefSeq, Dec 2017]



    About GMVC

    GDU

    GMVC (GM Vector Core) is GeneMedi’s unique platform for QbD Viral vectors Processes development and manufacturing. In GMVC, our core expertise lies in the tailored production of viral vectors, including adeno-associated virus (AAV), lentivirus, and adenovirus. Our state-of-the-art facilities are equipped for scalable manufacturing, ensuring high-quality viral vector production to meet both research and therapeutic needs. Our expert team specializes in process development, leveraging innovative technology and extensive industry knowledge to provide clients with tailored solutions that exceed expectations. GMVC will be the ideal partner for scientists and healthcare professionals seeking reliable and efficient viral vector production services.