Human VDAC3/HD-VDAC3/ VDAC-3 ORF/cDNA clone-Lentivirus plasmid (NM_005662)

Pre-made Human VDAC3/HD-VDAC3/ VDAC-3 Lentiviral expression plasmid for VDAC3 lentivirus packaging, VDAC3 lentivirus production, overexpression stable cell line development, cell transient transfection and gene delivery targeting T/B/NK cells, macrophages, cardiomyocytes, hepatocytes, and neurons.

Our GM-Lentiviral vector is seamlessly integrated with the GM lentivirus packaging system. Discover more about the GM lentivirus packaging system.

Target products collectionGo to VDAC3/HD-VDAC3 products collection >>
(antibodies, antigen, VLP, mRNA, ORF viral vector, etc)



Product information

Catalog No. Product Name Plasmid Grade Plasmid quantity
pGMLP003366 Human VDAC3 Lentivirus plasmid Research Grade 10mg, 50mg, 100mg, 500mg, >1g
GMP-like Grade 10mg, 50mg, 100mg, 500mg, >1g
High Quality (HQ) Grade
Seed 5ug


Product Description

Catalog ID pGMLP003366
Gene Name VDAC3
Accession Number NM_005662
Gene ID 7419
Species Human
Product Type Lentivirus plasmid (overexpression)
Insert Length 852 bp
Gene Alias HD-VDAC3, VDAC-3
Fluorescent Reporter ZsGreen
Mammalian Cell Selection Puromyocin
Fusion Tag 3xflag (C-Terminal)
Promoter CMV
Resistance Amplicin
Sequence ATGTGTAACACACCAACGTACTGTGACCTAGGAAAGGCTGCTAAGGATGTCTTCAACAAAGGATATGGCTTTGGCATGGTCAAGATAGACCTGAAAACCAAGTCTTGTAGTGGAGTGGAATTTTCTACTTCTGGTCATGCTTACACTGATACAGGGAAAGCATCAGGCAACCTAGAAACCAAATATAAGGTCTGTAACTATGGACTTACCTTCACCCAGAAATGGAACACAGACAATACTCTAGGGACAGAAATCTCTTGGGAGAATAAGTTGGCTGAAGGGTTGAAACTGACTCTTGATACCATATTTGTACCGAACACAGGAAAGAAGAGTGGGAAATTGAAGGCCTCCTATAAACGGGATTGTTTTAGTGTTGGCAGTAATGTTGATATAGATTTTTCTGGACCAACCATCTATGGCTGGGCTGTGTTGGCCTTCGAAGGGTGGCTTGCTGGCTATCAGATGAGTTTTGACACAGCCAAATCCAAACTGTCACAGAATAATTTCGCCCTGGGTTACAAGGCTGCGGACTTCCAGCTGCACACACATGTGAACGATGGCACTGAATTTGGAGGTTCTATCTACCAGAAGGTGAATGAGAAGATTGAAACATCCATAAACCTTGCTTGGACAGCTGGGAGTAACAACACCCGTTTTGGCATTGCTGCTAAGTACATGCTGGATTGTAGAACTTCTCTCTCTGCTAAAGTAAATAATGCCAGCCTGATTGGACTGGGTTATACTCAGACCCTTCGACCAGGAGTCAAATTGACTTTATCAGCTTTAATCGATGGGAAGAACTTCAGTGCAGGAGGTCACAAGGTTGGCTTGGGATTTGAACTGGAAGCTTAA

Reference




    Data / case study


    Click to get more Data / Case study about the product.



    Associated products


    Category Cat No. Products Name
    Target Antibody GM-Tg-g-IP0073-Ab Anti-VDAC3 monoclonal antibody
    Target Antigen GM-Tg-g-IP0073-Ag VDAC3 protein
    ORF Viral Vector pGMAD000188 Human VDAC3 Adenovirus plasmid
    ORF Viral Vector pGMLP003366 Human VDAC3 Lentivirus plasmid
    ORF Viral Vector vGMAD000188 Human VDAC3 Adenovirus particle
    ORF Viral Vector vGMLP003366 Human VDAC3 Lentivirus particle


    Target information

    Target ID GM-IP0073
    Target Name VDAC3
    Gene ID 7419, 22335, 705116, 83532, 101099117, 606963, 282716, 100050036
    Gene Symbol and Synonyms HD-VDAC3,VDAC-3,VDAC1P5,VDAC3,VDAC5P
    Uniprot Accession Q9Y277
    Uniprot Entry Name VDAC3_HUMAN
    Protein Sub-location Introcelluar Protein
    Category Therapeutics Target
    Disease Not Available
    Gene Ensembl ENSG00000078668
    Target Classification Not Available

    This gene encodes a voltage-dependent anion channel (VDAC), and belongs to the mitochondrial porin family. VDACs are small, integral membrane proteins that traverse the outer mitochondrial membrane and conduct ATP and other small metabolites. They are known to bind several kinases of intermediary metabolism, thought to be involved in translocation of adenine nucleotides, and are hypothesized to form part of the mitochondrial permeability transition pore, which results in the release of cytochrome c at the onset of apoptotic cell death. Alternatively transcript variants encoding different isoforms have been described for this gene. [provided by RefSeq, Oct 2011]



    About GMVC

    GDU



    GMVC (GM Vector Core) is GeneMedi’s unique platform for QbD Viral vectors Processes development and manufacturing. In GMVC, our core expertise lies in the tailored production of viral vectors, including adeno-associated virus (AAV), lentivirus, and adenovirus. Our state-of-the-art facilities are equipped for scalable manufacturing, ensuring high-quality viral vector production to meet both research and therapeutic needs. Our expert team specializes in process development, leveraging innovative technology and extensive industry knowledge to provide clients with tailored solutions that exceed expectations. GMVC will be the ideal partner for scientists and healthcare professionals seeking reliable and efficient viral vector production services.