Human VDAC3/HD-VDAC3/ VDAC-3 ORF/cDNA clone-Lentivirus plasmid (NM_005662)
Pre-made Human VDAC3/HD-VDAC3/ VDAC-3 Lentiviral expression plasmid for VDAC3 lentivirus packaging, VDAC3 lentivirus production, overexpression stable cell line development, cell transient transfection and gene delivery targeting T/B/NK cells, macrophages, cardiomyocytes, hepatocytes, and neurons.
Our GM-Lentiviral vector is seamlessly integrated with the GM lentivirus packaging system. Discover more about the GM lentivirus packaging system.
Go
to VDAC3/HD-VDAC3 products collection
>>
(antibodies,
antigen, VLP, mRNA, ORF viral vector, etc)
Product information
Catalog No. | Product Name | Plasmid Grade | Plasmid quantity |
---|---|---|---|
pGMLP003366 | Human VDAC3 Lentivirus plasmid | Research Grade | 10mg, 50mg, 100mg, 500mg, >1g |
GMP-like Grade | 10mg, 50mg, 100mg, 500mg, >1g | ||
High Quality (HQ) Grade | |||
Seed | 5ug |
Product Description
Catalog ID | pGMLP003366 |
Gene Name | VDAC3 |
Accession Number | NM_005662 |
Gene ID | 7419 |
Species | Human |
Product Type | Lentivirus plasmid (overexpression) |
Insert Length | 852 bp |
Gene Alias | HD-VDAC3, VDAC-3 |
Fluorescent Reporter | ZsGreen |
Mammalian Cell Selection | Puromyocin |
Fusion Tag | 3xflag (C-Terminal) |
Promoter | CMV |
Resistance | Amplicin |
Sequence | ATGTGTAACACACCAACGTACTGTGACCTAGGAAAGGCTGCTAAGGATGTCTTCAACAAAGGATATGGCTTTGGCATGGTCAAGATAGACCTGAAAACCAAGTCTTGTAGTGGAGTGGAATTTTCTACTTCTGGTCATGCTTACACTGATACAGGGAAAGCATCAGGCAACCTAGAAACCAAATATAAGGTCTGTAACTATGGACTTACCTTCACCCAGAAATGGAACACAGACAATACTCTAGGGACAGAAATCTCTTGGGAGAATAAGTTGGCTGAAGGGTTGAAACTGACTCTTGATACCATATTTGTACCGAACACAGGAAAGAAGAGTGGGAAATTGAAGGCCTCCTATAAACGGGATTGTTTTAGTGTTGGCAGTAATGTTGATATAGATTTTTCTGGACCAACCATCTATGGCTGGGCTGTGTTGGCCTTCGAAGGGTGGCTTGCTGGCTATCAGATGAGTTTTGACACAGCCAAATCCAAACTGTCACAGAATAATTTCGCCCTGGGTTACAAGGCTGCGGACTTCCAGCTGCACACACATGTGAACGATGGCACTGAATTTGGAGGTTCTATCTACCAGAAGGTGAATGAGAAGATTGAAACATCCATAAACCTTGCTTGGACAGCTGGGAGTAACAACACCCGTTTTGGCATTGCTGCTAAGTACATGCTGGATTGTAGAACTTCTCTCTCTGCTAAAGTAAATAATGCCAGCCTGATTGGACTGGGTTATACTCAGACCCTTCGACCAGGAGTCAAATTGACTTTATCAGCTTTAATCGATGGGAAGAACTTCAGTGCAGGAGGTCACAAGGTTGGCTTGGGATTTGAACTGGAAGCTTAA |
Reference
Data / case study
Click to get more Data / Case study about the product.
Associated products
Category | Cat No. | Products Name |
---|---|---|
Target Antibody | GM-Tg-g-IP0073-Ab | Anti-VDAC3 monoclonal antibody |
Target Antigen | GM-Tg-g-IP0073-Ag | VDAC3 protein |
ORF Viral Vector | pGMAD000188 | Human VDAC3 Adenovirus plasmid |
ORF Viral Vector | pGMLP003366 | Human VDAC3 Lentivirus plasmid |
ORF Viral Vector | vGMAD000188 | Human VDAC3 Adenovirus particle |
ORF Viral Vector | vGMLP003366 | Human VDAC3 Lentivirus particle |
Target information
Target ID | GM-IP0073 |
Target Name | VDAC3 |
Gene ID | 7419, 22335, 705116, 83532, 101099117, 606963, 282716, 100050036 |
Gene Symbol and Synonyms | HD-VDAC3,VDAC-3,VDAC1P5,VDAC3,VDAC5P |
Uniprot Accession | Q9Y277 |
Uniprot Entry Name | VDAC3_HUMAN |
Protein Sub-location | Introcelluar Protein |
Category | Therapeutics Target |
Disease | Not Available |
Gene Ensembl | ENSG00000078668 |
Target Classification | Not Available |
This gene encodes a voltage-dependent anion channel (VDAC), and belongs to the mitochondrial porin family. VDACs are small, integral membrane proteins that traverse the outer mitochondrial membrane and conduct ATP and other small metabolites. They are known to bind several kinases of intermediary metabolism, thought to be involved in translocation of adenine nucleotides, and are hypothesized to form part of the mitochondrial permeability transition pore, which results in the release of cytochrome c at the onset of apoptotic cell death. Alternatively transcript variants encoding different isoforms have been described for this gene. [provided by RefSeq, Oct 2011]
About GMVC
GMVC (GM Vector Core) is GeneMedi’s unique platform for QbD Viral vectors Processes development and manufacturing. In GMVC, our core expertise lies in the tailored production of viral vectors, including adeno-associated virus (AAV), lentivirus, and adenovirus. Our state-of-the-art facilities are equipped for scalable manufacturing, ensuring high-quality viral vector production to meet both research and therapeutic needs. Our expert team specializes in process development, leveraging innovative technology and extensive industry knowledge to provide clients with tailored solutions that exceed expectations. GMVC will be the ideal partner for scientists and healthcare professionals seeking reliable and efficient viral vector production services.