Human CCL1/I-309/ P500 ORF/cDNA clone-Lentivirus plasmid (NM_002981)

Pre-made Human CCL1/I-309/ P500 Lentiviral expression plasmid for CCL1 lentivirus packaging, CCL1 lentivirus production, overexpression stable cell line development, cell transient transfection and gene delivery targeting T/B/NK cells, macrophages, cardiomyocytes, hepatocytes, and neurons.

Our GM-Lentiviral vector is seamlessly integrated with the GM lentivirus packaging system. Discover more about the GM lentivirus packaging system.

Target products collectionGo to CCL1/I-309 products collection >>
(antibodies, antigen, VLP, mRNA, ORF viral vector, etc)



Product information

Catalog No. Product Name Plasmid Grade Plasmid quantity
pGMLP003376 Human CCL1 Lentivirus plasmid Research Grade 10mg, 50mg, 100mg, 500mg, >1g
GMP-like Grade 10mg, 50mg, 100mg, 500mg, >1g
High Quality (HQ) Grade
Seed 5ug


Product Description

Catalog ID pGMLP003376
Gene Name CCL1
Accession Number NM_002981
Gene ID 6346
Species Human
Product Type Lentivirus plasmid (overexpression)
Insert Length 291 bp
Gene Alias I-309, P500, SCYA1, SISe, TCA3
Fluorescent Reporter ZsGreen
Mammalian Cell Selection Puromyocin
Fusion Tag 3xflag (C-Terminal)
Promoter CMV
Resistance Amplicin
Sequence ATGCAGATCATCACCACAGCCCTGGTGTGCTTGCTGCTAGCTGGGATGTGGCCGGAAGATGTGGACAGCAAGAGCATGCAGGTACCCTTCTCCAGATGTTGCTTCTCATTTGCGGAGCAAGAGATTCCCCTGAGGGCAATCCTGTGTTACAGAAATACCAGCTCCATCTGCTCCAATGAGGGCTTAATATTCAAGCTGAAGAGAGGCAAAGAGGCCTGCGCCTTGGACACAGTTGGATGGGTTCAGAGGCACAGAAAAATGCTGAGGCACTGCCCGTCAAAAAGAAAATGA

Reference




    Data / case study


    Click to get more Data / Case study about the product.



    Associated products


    Category Cat No. Products Name
    Target Antibody GM-Tg-g-SE0738-Ab Anti-CCL1/ I-309/ P500 functional antibody
    Target Antigen GM-Tg-g-SE0738-Ag CCL1 protein
    Cytokine cks-Tg-g-GM-SE0738 chemokine (C-C motif) ligand 1 (CCL1) protein & antibody
    ORF Viral Vector pGMLP003376 Human CCL1 Lentivirus plasmid
    ORF Viral Vector vGMLP003376 Human CCL1 Lentivirus particle


    Target information

    Target ID GM-SE0738
    Target Name CCL1
    Gene ID 6346, 20290, 574177, 688605, 101100011, 448788, 786156, 102150259
    Gene Symbol and Synonyms CCL1,I-309,P500,SCYA1,SISe,Tca-3,TCA3
    Uniprot Accession P22362
    Uniprot Entry Name CCL1_HUMAN
    Protein Sub-location Secreted Protein/Potential Cytokines
    Category Cytokine Target
    Disease Not Available
    Gene Ensembl ENSG00000108702
    Target Classification Not Available

    This antimicrobial gene is one of several chemokine genes clustered on the q-arm of chromosome 17. Chemokines form a superfamily of secreted proteins involved in immunoregulatory and inflammatory processes. The superfamily is divided into four subfamilies based on the arrangement of the N-terminal cysteine residues of the mature peptide. This chemokine, a member of the CC subfamily, is secreted by activated T cells and displays chemotactic activity for monocytes but not for neutrophils. It binds to the chemokine (C-C motif) receptor 8. [provided by RefSeq, Sep 2014]



    About GMVC

    GDU



    GMVC (GM Vector Core) is GeneMedi’s unique platform for QbD Viral vectors Processes development and manufacturing. In GMVC, our core expertise lies in the tailored production of viral vectors, including adeno-associated virus (AAV), lentivirus, and adenovirus. Our state-of-the-art facilities are equipped for scalable manufacturing, ensuring high-quality viral vector production to meet both research and therapeutic needs. Our expert team specializes in process development, leveraging innovative technology and extensive industry knowledge to provide clients with tailored solutions that exceed expectations. GMVC will be the ideal partner for scientists and healthcare professionals seeking reliable and efficient viral vector production services.