Human VAMP8/EDB/VAMP-8 ORF/cDNA clone-Lentivirus plasmid (NM_003761)

Cat. No.: pGMLP003379
Size: 10 µg
Concentration: generally 0.5ug/ul, usually not less than 0.3ug/ul
Leading Time: 3-7 working days

Pre-made Human VAMP8/EDB/VAMP-8 Lentiviral expression plasmid for VAMP8 lentivirus packaging, VAMP8 lentivirus production, overexpression stable cell line development, cell transient transfection and gene delivery targeting T/B/NK cells, macrophages, cardiomyocytes, hepatocytes, and neurons.

Our GM-Lentiviral vector is seamlessly integrated with the GM lentivirus packaging system. Discover more about the GM lentivirus packaging system.

pdf Datasheet
pdf MSDS
pdf Terms of Use
Target products collection

Go to VAMP8/EDB products collection>>
(antibodies, antigen, VLP, mRNA, ORF viral vector, etc)

Purchase
Total Price: $450
Shipping fee: Limited-time free
For payment issues, contact us.


Product Description

Catalog ID pGMLP003379
Gene Name VAMP8
Accession Number NM_003761
Gene ID 8673
Species Human
Product Type Lentivirus plasmid (overexpression)
Insert Length 303 bp
Gene Alias EDB,VAMP-8
Fluorescent Reporter ZsGreen
Mammalian Cell Selection Puromyocin
Fusion Tag 3xflag (C-Terminal)
Promoter CMV
Resistance Amplicin
ORF Nucleotide Sequence ATGGAGGAAGCCAGTGAAGGTGGAGGAAATGATCGTGTGCGGAACCTGCAAAGTGAGGTGGAGGGAGTTAAGAATATTATGACCCAGAATGTGGAGCGGATCCTGGCCCGGGGGGAAAACTTGGAACATCTCCGCAACAAGACAGAGGATCTGGAAGCCACATCTGAGCACTTCAAGACGACATCGCAGAAGGTGGCTCGAAAATTCTGGTGGAAGAACGTGAAGATGATTGTCCTTATCTGCGTGATTGTTTTTATCATCATCCTCTTCATTGTGCTCTTTGCCACTGGTGCCTTCTCTTAA
ORF Protein Sequence MEEASEGGGNDRVRNLQSEVEGVKNIMTQNVERILARGENLEHLRNKTEDLEATSEHFKTTSQKVARKFWWKNVKMIVLICVIVFIIILFIVLFATGAFS

Reference




    Data / case study


    Click to get more Data / Case study about the product.



    Associated products


    Category Cat No. Products Name
    Target Antibody GM-Tg-g-MP1915-Ab Anti-VAMP8/ EDB/ VAMP-8 monoclonal antibody
    Target Antigen GM-Tg-g-MP1915-Ag VAMP8 VLP (virus-like particle)
    ORF Viral Vector pGMLP003379 Human VAMP8 Lentivirus plasmid
    ORF Viral Vector vGMLP003379 Human VAMP8 Lentivirus particle


    Target information

    Target ID GM-MP1915
    Target Name VAMP8
    Gene ID 8673, 22320, 695851, 83730, 101085880, 609784, 507309, 100053197
    Gene Symbol and Synonyms EDB,endobrevin,VAMP-8,VAMP8
    Uniprot Accession Q9BV40
    Uniprot Entry Name VAMP8_HUMAN
    Protein Sub-location Transmembrane Protein
    Category Not Available
    Disease Prostate Cancer
    Gene Ensembl ENSG00000118640
    Target Classification Not Available

    This gene encodes an integral membrane protein that belongs to the synaptobrevin/vesicle-associated membrane protein subfamily of soluble N-ethylmaleimide-sensitive factor attachment protein receptors (SNAREs). The encoded protein is involved in the fusion of synaptic vesicles with the presynaptic membrane.[provided by RefSeq, Jun 2010]



    About GMVC

    GDU

    GMVC (GM Vector Core) is GeneMedi’s unique platform for QbD Viral vectors Processes development and manufacturing. In GMVC, our core expertise lies in the tailored production of viral vectors, including adeno-associated virus (AAV), lentivirus, and adenovirus. Our state-of-the-art facilities are equipped for scalable manufacturing, ensuring high-quality viral vector production to meet both research and therapeutic needs. Our expert team specializes in process development, leveraging innovative technology and extensive industry knowledge to provide clients with tailored solutions that exceed expectations. GMVC will be the ideal partner for scientists and healthcare professionals seeking reliable and efficient viral vector production services.