Human S100A7/PSOR1/ S100A7c ORF/cDNA clone-Lentivirus plasmid (NM_002963)

Pre-made Human S100A7/PSOR1/ S100A7c Lentiviral expression plasmid for S100A7 lentivirus packaging, S100A7 lentivirus production, overexpression stable cell line development, cell transient transfection and gene delivery targeting T/B/NK cells, macrophages, cardiomyocytes, hepatocytes, and neurons.

Our GM-Lentiviral vector is seamlessly integrated with the GM lentivirus packaging system. Discover more about the GM lentivirus packaging system.

Target products collectionGo to S100A7/PSOR1 products collection >>
(antibodies, antigen, VLP, mRNA, ORF viral vector, etc)



Product information

Catalog No. Product Name Plasmid Grade Plasmid quantity
pGMLP003381 Human S100A7 Lentivirus plasmid Research Grade 10mg, 50mg, 100mg, 500mg, >1g
GMP-like Grade 10mg, 50mg, 100mg, 500mg, >1g
High Quality (HQ) Grade
Seed 5ug


Product Description

Catalog ID pGMLP003381
Gene Name S100A7
Accession Number NM_002963
Gene ID 6278
Species Human
Product Type Lentivirus plasmid (overexpression)
Insert Length 306 bp
Gene Alias PSOR1, S100A7c
Fluorescent Reporter ZsGreen
Mammalian Cell Selection Puromyocin
Fusion Tag 3xflag (C-Terminal)
Promoter CMV
Resistance Amplicin
Sequence ATGAGCAACACTCAAGCTGAGAGGTCCATAATAGGCATGATCGACATGTTTCACAAATACACCAGACGTGATGACAAGATTGAGAAGCCAAGCCTGCTGACGATGATGAAGGAGAACTTCCCCAACTTCCTTAGTGCCTGTGACAAAAAGGGCACAAATTACCTCGCCGATGTCTTTGAGAAAAAGGACAAGAATGAGGATAAGAAGATTGATTTTTCTGAGTTTCTGTCCTTGCTGGGAGACATAGCCACAGACTACCACAAGCAGAGCCATGGAGCAGCGCCCTGTTCCGGGGGCAGCCAGTGA

Reference




    Data / case study


    Click to get more Data / Case study about the product.



    Associated products


    Category Cat No. Products Name
    Target Antibody GM-Tg-g-SE1257-Ab Anti-S10A7/ S100A7/ PSOR1c functional antibody
    Target Antigen GM-Tg-g-SE1257-Ag S100A7 protein
    ORF Viral Vector pGMLP003381 Human S100A7 Lentivirus plasmid
    ORF Viral Vector pGMLP004010 Human S100A7 Lentivirus plasmid
    ORF Viral Vector vGMLP003381 Human S100A7 Lentivirus particle
    ORF Viral Vector vGMLP004010 Human S100A7 Lentivirus particle


    Target information

    Target ID GM-SE1257
    Target Name S100A7
    Gene ID 6278
    Gene Symbol and Synonyms PSOR1,S100A7,S100A7c
    Uniprot Accession P31151
    Uniprot Entry Name S10A7_HUMAN
    Protein Sub-location Secreted Protein/Potential Cytokines
    Category Not Available
    Disease Congenital occlusion of ureteropelvic junction
    Gene Ensembl ENSG00000143556
    Target Classification Not Available

    The protein encoded by this gene is a member of the S100 family of proteins containing 2 EF-hand calcium-binding motifs. S100 proteins are localized in the cytoplasm and/or nucleus of a wide range of cells, and involved in the regulation of a number of cellular processes such as cell cycle progression and differentiation. S100 genes include at least 13 members which are located as a cluster on chromosome 1q21. This protein differs from the other S100 proteins of known structure in its lack of calcium binding ability in one EF-hand at the N-terminus. The protein is overexpressed in hyperproliferative skin diseases, exhibits antimicrobial activities against bacteria and induces immunomodulatory activities. [provided by RefSeq, Nov 2014]



    About GMVC

    GDU



    GMVC (GM Vector Core) is GeneMedi’s unique platform for QbD Viral vectors Processes development and manufacturing. In GMVC, our core expertise lies in the tailored production of viral vectors, including adeno-associated virus (AAV), lentivirus, and adenovirus. Our state-of-the-art facilities are equipped for scalable manufacturing, ensuring high-quality viral vector production to meet both research and therapeutic needs. Our expert team specializes in process development, leveraging innovative technology and extensive industry knowledge to provide clients with tailored solutions that exceed expectations. GMVC will be the ideal partner for scientists and healthcare professionals seeking reliable and efficient viral vector production services.