Human S100A7/S100A7c ORF/cDNA clone-Lentivirus particle (BC034687)
Pre-made Human S100A7/S100A7c Lentiviral expression plasmid for S100A7 lentivirus packaging, S100A7 lentivirus production, overexpression stable cell line development, cell transient transfection and gene delivery targeting T/B/NK cells, macrophages, cardiomyocytes, hepatocytes, and neurons.
The GM Vector Core (GMVC) specializes in custom lentivirus development and offers a range of lentivirus manufacturing solutions, leveraging state-of-the-art processes. Learn more about our services.
Go
to S100A7/S100A7c products collection
>>
(antibodies,
antigen, VLP, mRNA, ORF viral vector, etc)
Product information
Catalog No. | Product Name | lentivirus Grade | lentivirus quantity |
---|---|---|---|
vGMLP004010 | Human S100A7 Lentivirus particle | Pilot Grade | 1.0E+8TU |
5.0E+8TU | |||
1.0E+9TU | |||
Research Grade | 1.0E+8TU | ||
5.0E+8TU | |||
1.0E+9TU | |||
GMP-like Grade | inquiry | ||
GMP Grade | inquiry |
Product Description
Catalog ID | vGMLP004010 |
Gene Name | S100A7 |
Accession Number | BC034687 |
Gene ID | 6278 |
Species | Human |
Product Type | Lentivirus particle (overexpression) |
Insert Length | 306 bp |
Gene Alias | S100A7c |
Fluorescent Reporter | ZsGreen |
Mammalian Cell Selection | Puromyocin |
Fusion Tag | 3xflag (C-Terminal) |
Promoter | CMV |
Resistance | Amplicin |
Sequence | ATGAGCAACACTCAAGCTGAGAGGTCCATAATAGGCATGATCGACATGTTTCACAAATACACCAGACGTGATGACAAGATTGACAAGCCAAGCCTGCTGACGATGATGAAGGAGAACTTCCCCAACTTCCTTAGTGCCTGTGACAAAAAGGGCACAAATTACCTCGCCGATGTCTTTGAGAAAAAGGACAAGAATGAGGATAAGAAGATTGATTTTTCTGAGTTTCTGTCCTTGCTGGGAGACATAGCCACAGACTACCACAAGCAGAGCCATGGAGCAGCGCCCTGTTCCGGGGGCAGCCAGTGA |
Reference
Data / case study
Click to get more Data / Case study about the product.
Associated products
Category | Cat No. | Products Name |
---|---|---|
Target Antibody | GM-Tg-g-SE1257-Ab | Anti-S10A7/ S100A7/ PSOR1c functional antibody |
Target Antigen | GM-Tg-g-SE1257-Ag | S100A7 protein |
ORF Viral Vector | pGMLP003381 | Human S100A7 Lentivirus plasmid |
ORF Viral Vector | pGMLP004010 | Human S100A7 Lentivirus plasmid |
ORF Viral Vector | vGMLP003381 | Human S100A7 Lentivirus particle |
ORF Viral Vector | vGMLP004010 | Human S100A7 Lentivirus particle |
Target information
Target ID | GM-SE1257 |
Target Name | S100A7 |
Gene ID | 6278 |
Gene Symbol and Synonyms | PSOR1,S100A7,S100A7c |
Uniprot Accession | P31151 |
Uniprot Entry Name | S10A7_HUMAN |
Protein Sub-location | Secreted Protein/Potential Cytokines |
Category | Not Available |
Disease | Congenital occlusion of ureteropelvic junction |
Gene Ensembl | ENSG00000143556 |
Target Classification | Not Available |
The protein encoded by this gene is a member of the S100 family of proteins containing 2 EF-hand calcium-binding motifs. S100 proteins are localized in the cytoplasm and/or nucleus of a wide range of cells, and involved in the regulation of a number of cellular processes such as cell cycle progression and differentiation. S100 genes include at least 13 members which are located as a cluster on chromosome 1q21. This protein differs from the other S100 proteins of known structure in its lack of calcium binding ability in one EF-hand at the N-terminus. The protein is overexpressed in hyperproliferative skin diseases, exhibits antimicrobial activities against bacteria and induces immunomodulatory activities. [provided by RefSeq, Nov 2014]
About GMVC
GMVC (GM Vector Core) is GeneMedi’s unique platform for QbD Viral vectors Processes development and manufacturing. In GMVC, our core expertise lies in the tailored production of viral vectors, including adeno-associated virus (AAV), lentivirus, and adenovirus. Our state-of-the-art facilities are equipped for scalable manufacturing, ensuring high-quality viral vector production to meet both research and therapeutic needs. Our expert team specializes in process development, leveraging innovative technology and extensive industry knowledge to provide clients with tailored solutions that exceed expectations. GMVC will be the ideal partner for scientists and healthcare professionals seeking reliable and efficient viral vector production services.