Human CCL15/HCC-2/ HMRP-2B ORF/cDNA clone-Lentivirus plasmid (NM_032965)
Pre-made Human CCL15/HCC-2/ HMRP-2B Lentiviral expression plasmid for CCL15 lentivirus packaging, CCL15 lentivirus production, overexpression stable cell line development, cell transient transfection and gene delivery targeting T/B/NK cells, macrophages, cardiomyocytes, hepatocytes, and neurons.
Our GM-Lentiviral vector is seamlessly integrated with the GM lentivirus packaging system. Discover more about the GM lentivirus packaging system.
Go
to CCL15/HCC-2 products collection
>>
(antibodies,
antigen, VLP, mRNA, ORF viral vector, etc)
Product information
Catalog No. | Product Name | Plasmid Grade | Plasmid quantity |
---|---|---|---|
pGMLP003385 | Human CCL15 Lentivirus plasmid | Research Grade | 10mg, 50mg, 100mg, 500mg, >1g |
GMP-like Grade | 10mg, 50mg, 100mg, 500mg, >1g | ||
High Quality (HQ) Grade | |||
Seed | 5ug |
Product Description
Catalog ID | pGMLP003385 |
Gene Name | CCL15 |
Accession Number | NM_032965 |
Gene ID | 6359 |
Species | Human |
Product Type | Lentivirus plasmid (overexpression) |
Insert Length | 342 bp |
Gene Alias | HCC-2, HMRP-2B, LKN-1, LKN1, MIP-1 delta, MIP-1D, MIP-5, MRP-2B, NCC-3, NCC3, SCYA15, SCYL3, SY15 |
Fluorescent Reporter | ZsGreen |
Mammalian Cell Selection | Puromyocin |
Fusion Tag | 3xflag (C-Terminal) |
Promoter | CMV |
Resistance | Amplicin |
Sequence | ATGAAGGTCTCCGTGGCTGCCCTCTCCTGCCTCATGCTTGTTGCTGTCCTTGGATCCCAGGCCCAGTTCACAAATGATGCAGAGACAGAGTTAATGATGTCAAAGCTTCCACTGGAAAATCCAGTAGTTCTGAACAGCTTTCACTTTGCTGCTGACTGCTGCACCTCCTACATCTCACAAAGCATCCCGTGTTCACTCATGAAAAGTTATTTTGAAACGAGCAGCGAGTGCTCCAAGCCAGGTGTCATATTCCTCACCAAGAAGGGGCGGCAAGTCTGTGCCAAACCCAGTGGTCCGGGAGTTCAGGATTGCATGAAAAAGCTGAAGCCCTACTCAATATAA |
Reference
Data / case study
Click to get more Data / Case study about the product.
Associated products
Category | Cat No. | Products Name |
---|---|---|
Target Antibody | GM-Tg-g-SE0069-Ab | Anti-CCL15/ HCC-2/ HMRP-2B functional antibody |
Target Antigen | GM-Tg-g-SE0069-Ag | CCL15 protein |
Cytokine | cks-Tg-g-GM-SE0069 | chemokine (C-C motif) ligand 15 (CCL15) protein & antibody |
ORF Viral Vector | pGMLP003385 | Human CCL15 Lentivirus plasmid |
ORF Viral Vector | vGMLP003385 | Human CCL15 Lentivirus particle |
Target information
Target ID | GM-SE0069 |
Target Name | CCL15 |
Gene ID | 6359, 100430368, 100071540 |
Gene Symbol and Synonyms | CCL15,HCC-2,HMRP-2B,LKN-1,LKN1,MIP-1 delta,MIP-1D,MIP-5,MRP-2B,NCC-3,NCC3,SCYA15,SCYL3,SY15 |
Uniprot Accession | Q16663 |
Uniprot Entry Name | CCL15_HUMAN |
Protein Sub-location | Secreted Protein/Potential Cytokines |
Category | Cytokine Target |
Disease | Lung Cancer |
Gene Ensembl | ENSG00000275718 |
Target Classification | Not Available |
This gene is located in a cluster of similar genes in the same region of chromosome 17. These genes encode CC cytokines, which are secreted proteins characterized by two adjacent cysteines. The product of this gene is chemotactic for T cells and monocytes, and acts through C-C chemokine receptor type 1 (CCR1). The proprotein is further processed into numerous smaller functional peptides. Naturally-occurring readthrough transcripts occur from this gene into the downstream gene, CCL14 (chemokine (C-C motif) ligand 14). [provided by RefSeq, Jan 2013]
About GMVC
GMVC (GM Vector Core) is GeneMedi’s unique platform for QbD Viral vectors Processes development and manufacturing. In GMVC, our core expertise lies in the tailored production of viral vectors, including adeno-associated virus (AAV), lentivirus, and adenovirus. Our state-of-the-art facilities are equipped for scalable manufacturing, ensuring high-quality viral vector production to meet both research and therapeutic needs. Our expert team specializes in process development, leveraging innovative technology and extensive industry knowledge to provide clients with tailored solutions that exceed expectations. GMVC will be the ideal partner for scientists and healthcare professionals seeking reliable and efficient viral vector production services.