Human CCL15/HCC-2/ HMRP-2B ORF/cDNA clone-Lentivirus particle (NM_032965)

Pre-made Human CCL15/HCC-2/ HMRP-2B Lentiviral expression plasmid for CCL15 lentivirus packaging, CCL15 lentivirus production, overexpression stable cell line development, cell transient transfection and gene delivery targeting T/B/NK cells, macrophages, cardiomyocytes, hepatocytes, and neurons.

The GM Vector Core (GMVC) specializes in custom lentivirus development and offers a range of lentivirus manufacturing solutions, leveraging state-of-the-art processes. Learn more about our services.

Target products collectionGo to CCL15/HCC-2 products collection >>
(antibodies, antigen, VLP, mRNA, ORF viral vector, etc)



Product information

Catalog No. Product Name lentivirus Grade lentivirus quantity
vGMLP003385 Human CCL15 Lentivirus particle Pilot Grade 1.0E+8TU
5.0E+8TU
1.0E+9TU
Research Grade 1.0E+8TU
5.0E+8TU
1.0E+9TU
GMP-like Grade inquiry
GMP Grade inquiry


Product Description

Catalog ID vGMLP003385
Gene Name CCL15
Accession Number NM_032965
Gene ID 6359
Species Human
Product Type Lentivirus particle (overexpression)
Insert Length 342 bp
Gene Alias HCC-2, HMRP-2B, LKN-1, LKN1, MIP-1 delta, MIP-1D, MIP-5, MRP-2B, NCC-3, NCC3, SCYA15, SCYL3, SY15
Fluorescent Reporter ZsGreen
Mammalian Cell Selection Puromyocin
Fusion Tag 3xflag (C-Terminal)
Promoter CMV
Resistance Amplicin
Sequence ATGAAGGTCTCCGTGGCTGCCCTCTCCTGCCTCATGCTTGTTGCTGTCCTTGGATCCCAGGCCCAGTTCACAAATGATGCAGAGACAGAGTTAATGATGTCAAAGCTTCCACTGGAAAATCCAGTAGTTCTGAACAGCTTTCACTTTGCTGCTGACTGCTGCACCTCCTACATCTCACAAAGCATCCCGTGTTCACTCATGAAAAGTTATTTTGAAACGAGCAGCGAGTGCTCCAAGCCAGGTGTCATATTCCTCACCAAGAAGGGGCGGCAAGTCTGTGCCAAACCCAGTGGTCCGGGAGTTCAGGATTGCATGAAAAAGCTGAAGCCCTACTCAATATAA

Reference




    Data / case study


    Click to get more Data / Case study about the product.



    Associated products


    Category Cat No. Products Name
    Target Antibody GM-Tg-g-SE0069-Ab Anti-CCL15/ HCC-2/ HMRP-2B functional antibody
    Target Antigen GM-Tg-g-SE0069-Ag CCL15 protein
    Cytokine cks-Tg-g-GM-SE0069 chemokine (C-C motif) ligand 15 (CCL15) protein & antibody
    ORF Viral Vector pGMLP003385 Human CCL15 Lentivirus plasmid
    ORF Viral Vector vGMLP003385 Human CCL15 Lentivirus particle


    Target information

    Target ID GM-SE0069
    Target Name CCL15
    Gene ID 6359, 100430368, 100071540
    Gene Symbol and Synonyms CCL15,HCC-2,HMRP-2B,LKN-1,LKN1,MIP-1 delta,MIP-1D,MIP-5,MRP-2B,NCC-3,NCC3,SCYA15,SCYL3,SY15
    Uniprot Accession Q16663
    Uniprot Entry Name CCL15_HUMAN
    Protein Sub-location Secreted Protein/Potential Cytokines
    Category Cytokine Target
    Disease Lung Cancer
    Gene Ensembl ENSG00000275718
    Target Classification Not Available

    This gene is located in a cluster of similar genes in the same region of chromosome 17. These genes encode CC cytokines, which are secreted proteins characterized by two adjacent cysteines. The product of this gene is chemotactic for T cells and monocytes, and acts through C-C chemokine receptor type 1 (CCR1). The proprotein is further processed into numerous smaller functional peptides. Naturally-occurring readthrough transcripts occur from this gene into the downstream gene, CCL14 (chemokine (C-C motif) ligand 14). [provided by RefSeq, Jan 2013]



    About GMVC

    GDU



    GMVC (GM Vector Core) is GeneMedi’s unique platform for QbD Viral vectors Processes development and manufacturing. In GMVC, our core expertise lies in the tailored production of viral vectors, including adeno-associated virus (AAV), lentivirus, and adenovirus. Our state-of-the-art facilities are equipped for scalable manufacturing, ensuring high-quality viral vector production to meet both research and therapeutic needs. Our expert team specializes in process development, leveraging innovative technology and extensive industry knowledge to provide clients with tailored solutions that exceed expectations. GMVC will be the ideal partner for scientists and healthcare professionals seeking reliable and efficient viral vector production services.