Human ESM1/endocan ORF/cDNA clone-Lentivirus plasmid (NM_007036)

Pre-made Human ESM1/endocan Lentiviral expression plasmid for ESM1 lentivirus packaging, ESM1 lentivirus production, overexpression stable cell line development, cell transient transfection and gene delivery targeting T/B/NK cells, macrophages, cardiomyocytes, hepatocytes, and neurons.

Our GM-Lentiviral vector is seamlessly integrated with the GM lentivirus packaging system. Discover more about the GM lentivirus packaging system.

Target products collectionGo to ESM1/endocan products collection >>
(antibodies, antigen, VLP, mRNA, ORF viral vector, etc)



Product information

Catalog No. Product Name Plasmid Grade Plasmid quantity
pGMLP003427 Human ESM1 Lentivirus plasmid Research Grade 10mg, 50mg, 100mg, 500mg, >1g
GMP-like Grade 10mg, 50mg, 100mg, 500mg, >1g
High Quality (HQ) Grade
Seed 5ug


Product Description

Catalog ID pGMLP003427
Gene Name ESM1
Accession Number NM_007036
Gene ID 11082
Species Human
Product Type Lentivirus plasmid (overexpression)
Insert Length 555 bp
Gene Alias endocan
Fluorescent Reporter ZsGreen
Mammalian Cell Selection Puromyocin
Fusion Tag 3xflag (C-Terminal)
Promoter CMV
Resistance Amplicin
Sequence ATGAAGAGCGTCTTGCTGCTGACCACGCTCCTCGTGCCTGCACACCTGGTGGCCGCCTGGAGCAATAATTATGCGGTGGACTGCCCTCAACACTGTGACAGCAGTGAGTGCAAAAGCAGCCCGCGCTGCAAGAGGACAGTGCTCGACGACTGTGGCTGCTGCCGAGTGTGCGCTGCAGGGCGGGGAGAAACTTGCTACCGCACAGTCTCAGGCATGGATGGCATGAAGTGTGGCCCGGGGCTGAGGTGTCAGCCTTCTAATGGGGAGGATCCTTTTGGTGAAGAGTTTGGTATCTGCAAAGACTGTCCCTACGGCACCTTCGGGATGGATTGCAGAGAGACCTGCAACTGCCAGTCAGGCATCTGTGACAGGGGGACGGGAAAATGCCTGAAATTCCCCTTCTTCCAATATTCAGTAACCAAGTCTTCCAACAGATTTGTTTCTCTCACGGAGCATGACATGGCATCTGGAGATGGCAATATTGTGAGAGAAGAAGTTGTGAAAGAGAATGCTGCCGGGTCTCCCGTAATGAGGAAATGGTTAAATCCACGCTGA

Reference




    Data / case study


    Click to get more Data / Case study about the product.



    Associated products


    Category Cat No. Products Name
    Target Antibody GM-Tg-g-SE0909-Ab Anti-ESM1/ endocan functional antibody
    Target Antigen GM-Tg-g-SE0909-Ag ESM1 protein
    Cytokine cks-Tg-g-GM-SE0909 endothelial cell-specific molecule 1 (ESM1) protein & antibody
    ORF Viral Vector pGMLP003427 Human ESM1 Lentivirus plasmid
    ORF Viral Vector vGMLP003427 Human ESM1 Lentivirus particle


    Target information

    Target ID GM-SE0909
    Target Name ESM1
    Gene ID 11082, 71690, 705229, 64536, 101088303, 489201, 539571, 100052185
    Gene Symbol and Synonyms 0610042H23Rik,endocan,ESM-1,ESM1,Pg25
    Uniprot Accession Q9NQ30
    Uniprot Entry Name ESM1_HUMAN
    Protein Sub-location Secreted Protein/Potential Cytokines
    Category Cytokine Target
    Disease Breast Cancer, Ovary Cancer
    Gene Ensembl ENSG00000164283
    Target Classification Not Available

    This gene encodes a secreted protein which is mainly expressed in the endothelial cells in human lung and kidney tissues. The expression of this gene is regulated by cytokines, suggesting that it may play a role in endothelium-dependent pathological disorders. The transcript contains multiple polyadenylation and mRNA instability signals. Two transcript variants encoding different isoforms have been found for this gene. [provided by RefSeq, Oct 2008]



    About GMVC

    GDU



    GMVC (GM Vector Core) is GeneMedi’s unique platform for QbD Viral vectors Processes development and manufacturing. In GMVC, our core expertise lies in the tailored production of viral vectors, including adeno-associated virus (AAV), lentivirus, and adenovirus. Our state-of-the-art facilities are equipped for scalable manufacturing, ensuring high-quality viral vector production to meet both research and therapeutic needs. Our expert team specializes in process development, leveraging innovative technology and extensive industry knowledge to provide clients with tailored solutions that exceed expectations. GMVC will be the ideal partner for scientists and healthcare professionals seeking reliable and efficient viral vector production services.