Human ESM1/endocan ORF/cDNA clone-Lentivirus particle (NM_007036)
Pre-made Human ESM1/endocan Lentiviral expression plasmid for ESM1 lentivirus packaging, ESM1 lentivirus production, overexpression stable cell line development, cell transient transfection and gene delivery targeting T/B/NK cells, macrophages, cardiomyocytes, hepatocytes, and neurons.
The GM Vector Core (GMVC) specializes in custom lentivirus development and offers a range of lentivirus manufacturing solutions, leveraging state-of-the-art processes. Learn more about our services.
Go
to ESM1/endocan products collection
>>
(antibodies,
antigen, VLP, mRNA, ORF viral vector, etc)
Product information
Catalog No. | Product Name | lentivirus Grade | lentivirus quantity |
---|---|---|---|
vGMLP003427 | Human ESM1 Lentivirus particle | Pilot Grade | 1.0E+8TU |
5.0E+8TU | |||
1.0E+9TU | |||
Research Grade | 1.0E+8TU | ||
5.0E+8TU | |||
1.0E+9TU | |||
GMP-like Grade | inquiry | ||
GMP Grade | inquiry |
Product Description
Catalog ID | vGMLP003427 |
Gene Name | ESM1 |
Accession Number | NM_007036 |
Gene ID | 11082 |
Species | Human |
Product Type | Lentivirus particle (overexpression) |
Insert Length | 555 bp |
Gene Alias | endocan |
Fluorescent Reporter | ZsGreen |
Mammalian Cell Selection | Puromyocin |
Fusion Tag | 3xflag (C-Terminal) |
Promoter | CMV |
Resistance | Amplicin |
Sequence | ATGAAGAGCGTCTTGCTGCTGACCACGCTCCTCGTGCCTGCACACCTGGTGGCCGCCTGGAGCAATAATTATGCGGTGGACTGCCCTCAACACTGTGACAGCAGTGAGTGCAAAAGCAGCCCGCGCTGCAAGAGGACAGTGCTCGACGACTGTGGCTGCTGCCGAGTGTGCGCTGCAGGGCGGGGAGAAACTTGCTACCGCACAGTCTCAGGCATGGATGGCATGAAGTGTGGCCCGGGGCTGAGGTGTCAGCCTTCTAATGGGGAGGATCCTTTTGGTGAAGAGTTTGGTATCTGCAAAGACTGTCCCTACGGCACCTTCGGGATGGATTGCAGAGAGACCTGCAACTGCCAGTCAGGCATCTGTGACAGGGGGACGGGAAAATGCCTGAAATTCCCCTTCTTCCAATATTCAGTAACCAAGTCTTCCAACAGATTTGTTTCTCTCACGGAGCATGACATGGCATCTGGAGATGGCAATATTGTGAGAGAAGAAGTTGTGAAAGAGAATGCTGCCGGGTCTCCCGTAATGAGGAAATGGTTAAATCCACGCTGA |
Reference
Data / case study
Click to get more Data / Case study about the product.
Associated products
Category | Cat No. | Products Name |
---|---|---|
Target Antibody | GM-Tg-g-SE0909-Ab | Anti-ESM1/ endocan functional antibody |
Target Antigen | GM-Tg-g-SE0909-Ag | ESM1 protein |
Cytokine | cks-Tg-g-GM-SE0909 | endothelial cell-specific molecule 1 (ESM1) protein & antibody |
ORF Viral Vector | pGMLP003427 | Human ESM1 Lentivirus plasmid |
ORF Viral Vector | vGMLP003427 | Human ESM1 Lentivirus particle |
Target information
Target ID | GM-SE0909 |
Target Name | ESM1 |
Gene ID | 11082, 71690, 705229, 64536, 101088303, 489201, 539571, 100052185 |
Gene Symbol and Synonyms | 0610042H23Rik,endocan,ESM-1,ESM1,Pg25 |
Uniprot Accession | Q9NQ30 |
Uniprot Entry Name | ESM1_HUMAN |
Protein Sub-location | Secreted Protein/Potential Cytokines |
Category | Cytokine Target |
Disease | Breast Cancer, Ovary Cancer |
Gene Ensembl | ENSG00000164283 |
Target Classification | Not Available |
This gene encodes a secreted protein which is mainly expressed in the endothelial cells in human lung and kidney tissues. The expression of this gene is regulated by cytokines, suggesting that it may play a role in endothelium-dependent pathological disorders. The transcript contains multiple polyadenylation and mRNA instability signals. Two transcript variants encoding different isoforms have been found for this gene. [provided by RefSeq, Oct 2008]
About GMVC
GMVC (GM Vector Core) is GeneMedi’s unique platform for QbD Viral vectors Processes development and manufacturing. In GMVC, our core expertise lies in the tailored production of viral vectors, including adeno-associated virus (AAV), lentivirus, and adenovirus. Our state-of-the-art facilities are equipped for scalable manufacturing, ensuring high-quality viral vector production to meet both research and therapeutic needs. Our expert team specializes in process development, leveraging innovative technology and extensive industry knowledge to provide clients with tailored solutions that exceed expectations. GMVC will be the ideal partner for scientists and healthcare professionals seeking reliable and efficient viral vector production services.