Human DNAJC5/CLN4/CLN4B ORF/cDNA clone-Lentivirus plasmid (NM_025219)
Cat. No.: pGMLP003435
Size: 10 µg
Concentration: generally 0.5ug/ul, usually not less than 0.3ug/ul
Leading Time: 3-7 working days
Pre-made Human DNAJC5/CLN4/CLN4B Lentiviral expression plasmid for DNAJC5 lentivirus packaging, DNAJC5 lentivirus production, overexpression stable cell line development, cell transient transfection and gene delivery targeting T/B/NK cells, macrophages, cardiomyocytes, hepatocytes, and neurons.
Our GM-Lentiviral vector is seamlessly integrated with the GM lentivirus packaging system. Discover more about the GM lentivirus packaging system.
Go to
DNAJC5/CLN4 products
collection>>
(antibodies,
antigen, VLP, mRNA, ORF viral vector, etc)
Product Description
Catalog ID | pGMLP003435 |
Gene Name | DNAJC5 |
Accession Number | NM_025219 |
Gene ID | 80331 |
Species | Human |
Product Type | Lentivirus plasmid (overexpression) |
Insert Length | 597 bp |
Gene Alias | CLN4,CLN4B,CSP,DNAJC5A,mir-941-2,mir-941-3,mir-941-4,mir-941-5,NCL |
Fluorescent Reporter | ZsGreen |
Mammalian Cell Selection | Puromyocin |
Fusion Tag | 3xflag (C-Terminal) |
Promoter | CMV |
Resistance | Amplicin |
ORF Nucleotide Sequence | ATGGCAGACCAGAGACAGCGCTCACTGTCTACCTCTGGGGAGTCATTGTACCACGTCCTTGGGTTGGACAAGAACGCAACCTCAGATGACATTAAAAAGTCCTATCGGAAGCTTGCCTTGAAATATCACCCCGACAAGAACCCCGACAACCCGGAGGCCGCGGACAAGTTTAAGGAGATCAACAACGCGCACGCCATCCTCACGGACGCCACAAAAAGGAACATCTACGACAAGTACGGCTCGCTGGGTCTCTACGTGGCCGAGCAGTTTGGGGAAGAGAACGTGAACACCTACTTCGTGCTGTCCAGCTGGTGGGCCAAGGCCCTGTTTGTCTTCTGCGGCCTCCTCACGTGCTGCTACTGCTGCTGCTGTCTGTGCTGCTGCTTCAACTGCTGCTGCGGGAAGTGTAAGCCCAAGGCGCCTGAAGGCGAGGAGACGGAGTTCTACGTGTCCCCCGAGGATCTGGAGGCACAGCTGCAGTCTGACGAGAGGGAGGCCACAGACACGCCGATCGTCATACAGCCGGCATCCGCCACCGAGACCACCCAGCTCACAGCCGACTCCCACCCCAGCTACCACACTGACGGGTTCAACTAA |
ORF Protein Sequence | MADQRQRSLSTSGESLYHVLGLDKNATSDDIKKSYRKLALKYHPDKNPDNPEAADKFKEINNAHAILTDATKRNIYDKYGSLGLYVAEQFGEENVNTYFVLSSWWAKALFVFCGLLTCCYCCCCLCCCFNCCCGKCKPKAPEGEETEFYVSPEDLEAQLQSDEREATDTPIVIQPASATETTQLTADSHPSYHTDGFN |
Reference
Data / case study
Click to get more Data / Case study about the product.
Associated products
Category | Cat No. | Products Name |
---|---|---|
Target Antibody | GM-Tg-g-MP0366-Ab | Anti-DNJC5/ DNAJC5/ CLN4 monoclonal antibody |
Target Antigen | GM-Tg-g-MP0366-Ag | DNAJC5 VLP (virus-like particle) |
ORF Viral Vector | pGMLP003435 | Human DNAJC5 Lentivirus plasmid |
ORF Viral Vector | vGMLP003435 | Human DNAJC5 Lentivirus particle |
Target information
Target ID | GM-MP0366 |
Target Name | DNAJC5 |
Gene ID | 80331, 13002, 694810, 79130, 101092017, 119865743, 282216, 100051629 |
Gene Symbol and Synonyms | 2610314I24Rik,CLN4,CLN4B,CSP,DNAJC5,DNAJC5A,mir-941-2,mir-941-3,mir-941-4,mir-941-5,NCL |
Uniprot Accession | Q9H3Z4 |
Uniprot Entry Name | DNJC5_HUMAN |
Protein Sub-location | Transmembrane Protein |
Category | Not Available |
Disease | Not Available |
Gene Ensembl | ENSG00000101152 |
Target Classification | Not Available |
This gene is a member of the J protein family. J proteins function in many cellular processes by regulating the ATPase activity of 70 kDa heat shock proteins. The encoded protein plays a role in membrane trafficking and protein folding, and has been shown to have anti-neurodegenerative properties. The encoded protein is known to play a role in cystic fibrosis and Huntington's disease. A pseudogene of this gene is located on the short arm of chromosome 8. [provided by RefSeq, Nov 2010]
About GMVC
GMVC (GM Vector Core) is GeneMedi’s unique platform for QbD Viral vectors Processes development and manufacturing. In GMVC, our core expertise lies in the tailored production of viral vectors, including adeno-associated virus (AAV), lentivirus, and adenovirus. Our state-of-the-art facilities are equipped for scalable manufacturing, ensuring high-quality viral vector production to meet both research and therapeutic needs. Our expert team specializes in process development, leveraging innovative technology and extensive industry knowledge to provide clients with tailored solutions that exceed expectations. GMVC will be the ideal partner for scientists and healthcare professionals seeking reliable and efficient viral vector production services.