Human TNFSF14/CD258/ HVEML ORF/cDNA clone-Lentivirus plasmid (NM_003807)

Pre-made Human TNFSF14/CD258/ HVEML Lentiviral expression plasmid for TNFSF14 lentivirus packaging, TNFSF14 lentivirus production, overexpression stable cell line development, cell transient transfection and gene delivery targeting T/B/NK cells, macrophages, cardiomyocytes, hepatocytes, and neurons.

Our GM-Lentiviral vector is seamlessly integrated with the GM lentivirus packaging system. Discover more about the GM lentivirus packaging system.

Target products collectionGo to TNFSF14/CD258 products collection >>
(antibodies, antigen, VLP, mRNA, ORF viral vector, etc)



Product information

Catalog No. Product Name Plasmid Grade Plasmid quantity
pGMLP003477 Human TNFSF14 Lentivirus plasmid Research Grade 10mg, 50mg, 100mg, 500mg, >1g
GMP-like Grade 10mg, 50mg, 100mg, 500mg, >1g
High Quality (HQ) Grade
Seed 5ug


Product Description

Catalog ID pGMLP003477
Gene Name TNFSF14
Accession Number NM_003807
Gene ID 8740
Species Human
Product Type Lentivirus plasmid (overexpression)
Insert Length 723 bp
Gene Alias CD258, HVEML, LIGHT, LTg
Fluorescent Reporter ZsGreen
Mammalian Cell Selection Puromyocin
Fusion Tag 3xflag (C-Terminal)
Promoter CMV
Resistance Amplicin
Sequence ATGGAGGAGAGTGTCGTACGGCCCTCAGTGTTTGTGGTGGATGGACAGACCGACATCCCATTCACGAGGCTGGGACGAAGCCACCGGAGACAGTCGTGCAGTGTGGCCCGGGTGGGTCTGGGTCTCTTGCTGTTGCTGATGGGGGCCGGGCTGGCCGTCCAAGGCTGGTTCCTCCTGCAGCTGCACTGGCGTCTAGGAGAGATGGTCACCCGCCTGCCTGACGGACCTGCAGGCTCCTGGGAGCAGCTGATACAAGAGCGAAGGTCTCACGAGGTCAACCCAGCAGCGCATCTCACAGGGGCCAACTCCAGCTTGACCGGCAGCGGGGGGCCGCTGTTATGGGAGACTCAGCTGGGCCTGGCCTTCCTGAGGGGCCTCAGCTACCACGATGGGGCCCTTGTGGTCACCAAAGCTGGCTACTACTACATCTACTCCAAGGTGCAGCTGGGCGGTGTGGGCTGCCCGCTGGGCCTGGCCAGCACCATCACCCACGGCCTCTACAAGCGCACACCCCGCTACCCCGAGGAGCTGGAGCTGTTGGTCAGCCAGCAGTCACCCTGCGGACGGGCCACCAGCAGCTCCCGGGTCTGGTGGGACAGCAGCTTCCTGGGTGGTGTGGTACACCTGGAGGCTGGGGAGAAGGTGGTCGTCCGTGTGCTGGATGAACGCCTGGTTCGACTGCGTGATGGTACCCGGTCTTACTTCGGGGCTTTCATGGTGTGA

Reference




    Data / case study


    Click to get more Data / Case study about the product.



    Associated products


    Category Cat No. Products Name
    Biosimilar GMP-Bios-ab-688 Pre-Made Quisovalimab biosimilar, Whole mAb, Anti-TNFSF14/CD258 Antibody: Anti-HVEML/LIGHT/LTg therapeutic antibody
    Target Antibody GM-Tg-g-MP1857-Ab Anti-TNF14/ TNFSF14/ CD258 monoclonal antibody
    Target Antigen GM-Tg-g-MP1857-Ag TNFSF14 VLP (virus-like particle)
    Cytokine cks-Tg-g-GM-MP1857 Tumor necrosis factor superfamily member 14 (TNFSF14) protein & antibody
    ORF Viral Vector pGMLP003477 Human TNFSF14 Lentivirus plasmid
    ORF Viral Vector vGMLP003477 Human TNFSF14 Lentivirus particle


    Target information

    Target ID GM-MP1857
    Target Name TNFSF14
    Gene ID 8740, 50930, 701451, 301133, 101096542, 611306, 505521, 100060470
    Gene Symbol and Synonyms CD258,HVEM-L,HVEML,LIGHT,LTg,Ly113,TNFSF14,Tnlg1d
    Uniprot Accession O43557
    Uniprot Entry Name TNF14_HUMAN
    Protein Sub-location Transmembrane Protein
    Category Therapeutics Target, INN Index, Cytokine Target
    Disease Not Available
    Gene Ensembl ENSG00000125735
    Target Classification Not Available

    The protein encoded by this gene is a member of the tumor necrosis factor (TNF) ligand family. This protein is a ligand for TNFRSF14, which is a member of the tumor necrosis factor receptor superfamily, and which is also known as a herpesvirus entry mediator (HVEM). This protein may function as a costimulatory factor for the activation of lymphoid cells and as a deterrent to infection by herpesvirus. This protein has been shown to stimulate the proliferation of T cells, and trigger apoptosis of various tumor cells. This protein is also reported to prevent tumor necrosis factor alpha mediated apoptosis in primary hepatocyte. Two alternatively spliced transcript variant encoding distinct isoforms have been reported. [provided by RefSeq, Jul 2008]



    About GMVC

    GDU



    GMVC (GM Vector Core) is GeneMedi’s unique platform for QbD Viral vectors Processes development and manufacturing. In GMVC, our core expertise lies in the tailored production of viral vectors, including adeno-associated virus (AAV), lentivirus, and adenovirus. Our state-of-the-art facilities are equipped for scalable manufacturing, ensuring high-quality viral vector production to meet both research and therapeutic needs. Our expert team specializes in process development, leveraging innovative technology and extensive industry knowledge to provide clients with tailored solutions that exceed expectations. GMVC will be the ideal partner for scientists and healthcare professionals seeking reliable and efficient viral vector production services.