Human TNFSF14/CD258/ HVEML ORF/cDNA clone-Lentivirus plasmid (NM_003807)
Pre-made Human TNFSF14/CD258/ HVEML Lentiviral expression plasmid for TNFSF14 lentivirus packaging, TNFSF14 lentivirus production, overexpression stable cell line development, cell transient transfection and gene delivery targeting T/B/NK cells, macrophages, cardiomyocytes, hepatocytes, and neurons.
Our GM-Lentiviral vector is seamlessly integrated with the GM lentivirus packaging system. Discover more about the GM lentivirus packaging system.
Go
to TNFSF14/CD258 products collection
>>
(antibodies,
antigen, VLP, mRNA, ORF viral vector, etc)
Product information
Catalog No. | Product Name | Plasmid Grade | Plasmid quantity |
---|---|---|---|
pGMLP003477 | Human TNFSF14 Lentivirus plasmid | Research Grade | 10mg, 50mg, 100mg, 500mg, >1g |
GMP-like Grade | 10mg, 50mg, 100mg, 500mg, >1g | ||
High Quality (HQ) Grade | |||
Seed | 5ug |
Product Description
Catalog ID | pGMLP003477 |
Gene Name | TNFSF14 |
Accession Number | NM_003807 |
Gene ID | 8740 |
Species | Human |
Product Type | Lentivirus plasmid (overexpression) |
Insert Length | 723 bp |
Gene Alias | CD258, HVEML, LIGHT, LTg |
Fluorescent Reporter | ZsGreen |
Mammalian Cell Selection | Puromyocin |
Fusion Tag | 3xflag (C-Terminal) |
Promoter | CMV |
Resistance | Amplicin |
Sequence | ATGGAGGAGAGTGTCGTACGGCCCTCAGTGTTTGTGGTGGATGGACAGACCGACATCCCATTCACGAGGCTGGGACGAAGCCACCGGAGACAGTCGTGCAGTGTGGCCCGGGTGGGTCTGGGTCTCTTGCTGTTGCTGATGGGGGCCGGGCTGGCCGTCCAAGGCTGGTTCCTCCTGCAGCTGCACTGGCGTCTAGGAGAGATGGTCACCCGCCTGCCTGACGGACCTGCAGGCTCCTGGGAGCAGCTGATACAAGAGCGAAGGTCTCACGAGGTCAACCCAGCAGCGCATCTCACAGGGGCCAACTCCAGCTTGACCGGCAGCGGGGGGCCGCTGTTATGGGAGACTCAGCTGGGCCTGGCCTTCCTGAGGGGCCTCAGCTACCACGATGGGGCCCTTGTGGTCACCAAAGCTGGCTACTACTACATCTACTCCAAGGTGCAGCTGGGCGGTGTGGGCTGCCCGCTGGGCCTGGCCAGCACCATCACCCACGGCCTCTACAAGCGCACACCCCGCTACCCCGAGGAGCTGGAGCTGTTGGTCAGCCAGCAGTCACCCTGCGGACGGGCCACCAGCAGCTCCCGGGTCTGGTGGGACAGCAGCTTCCTGGGTGGTGTGGTACACCTGGAGGCTGGGGAGAAGGTGGTCGTCCGTGTGCTGGATGAACGCCTGGTTCGACTGCGTGATGGTACCCGGTCTTACTTCGGGGCTTTCATGGTGTGA |
Reference
Data / case study
Click to get more Data / Case study about the product.
Associated products
Category | Cat No. | Products Name |
---|---|---|
Biosimilar | GMP-Bios-ab-688 | Pre-Made Quisovalimab biosimilar, Whole mAb, Anti-TNFSF14/CD258 Antibody: Anti-HVEML/LIGHT/LTg therapeutic antibody |
Target Antibody | GM-Tg-g-MP1857-Ab | Anti-TNF14/ TNFSF14/ CD258 monoclonal antibody |
Target Antigen | GM-Tg-g-MP1857-Ag | TNFSF14 VLP (virus-like particle) |
Cytokine | cks-Tg-g-GM-MP1857 | Tumor necrosis factor superfamily member 14 (TNFSF14) protein & antibody |
ORF Viral Vector | pGMLP003477 | Human TNFSF14 Lentivirus plasmid |
ORF Viral Vector | vGMLP003477 | Human TNFSF14 Lentivirus particle |
Target information
Target ID | GM-MP1857 |
Target Name | TNFSF14 |
Gene ID | 8740, 50930, 701451, 301133, 101096542, 611306, 505521, 100060470 |
Gene Symbol and Synonyms | CD258,HVEM-L,HVEML,LIGHT,LTg,Ly113,TNFSF14,Tnlg1d |
Uniprot Accession | O43557 |
Uniprot Entry Name | TNF14_HUMAN |
Protein Sub-location | Transmembrane Protein |
Category | Therapeutics Target, INN Index, Cytokine Target |
Disease | Not Available |
Gene Ensembl | ENSG00000125735 |
Target Classification | Not Available |
The protein encoded by this gene is a member of the tumor necrosis factor (TNF) ligand family. This protein is a ligand for TNFRSF14, which is a member of the tumor necrosis factor receptor superfamily, and which is also known as a herpesvirus entry mediator (HVEM). This protein may function as a costimulatory factor for the activation of lymphoid cells and as a deterrent to infection by herpesvirus. This protein has been shown to stimulate the proliferation of T cells, and trigger apoptosis of various tumor cells. This protein is also reported to prevent tumor necrosis factor alpha mediated apoptosis in primary hepatocyte. Two alternatively spliced transcript variant encoding distinct isoforms have been reported. [provided by RefSeq, Jul 2008]
About GMVC
GMVC (GM Vector Core) is GeneMedi’s unique platform for QbD Viral vectors Processes development and manufacturing. In GMVC, our core expertise lies in the tailored production of viral vectors, including adeno-associated virus (AAV), lentivirus, and adenovirus. Our state-of-the-art facilities are equipped for scalable manufacturing, ensuring high-quality viral vector production to meet both research and therapeutic needs. Our expert team specializes in process development, leveraging innovative technology and extensive industry knowledge to provide clients with tailored solutions that exceed expectations. GMVC will be the ideal partner for scientists and healthcare professionals seeking reliable and efficient viral vector production services.