Human SGCD/35DAG/CMD1L ORF/cDNA clone-Lentivirus plasmid (NM_000337)

Cat. No.: pGMLP003514
Size: 10 µg
Concentration: generally 0.5ug/ul, usually not less than 0.3ug/ul
Leading Time: 3-7 working days

Pre-made Human SGCD/35DAG/CMD1L Lentiviral expression plasmid for SGCD lentivirus packaging, SGCD lentivirus production, overexpression stable cell line development, cell transient transfection and gene delivery targeting T/B/NK cells, macrophages, cardiomyocytes, hepatocytes, and neurons.

Our GM-Lentiviral vector is seamlessly integrated with the GM lentivirus packaging system. Discover more about the GM lentivirus packaging system.


Target products collection

Go to SGCD/35DAG products collection>>
(antibodies, antigen, VLP, mRNA, ORF viral vector, etc)

Purchase
Total Price: $518.25
Shipping fee: Limited-time free
For payment issues, contact us.


Product Description

Catalog ID pGMLP003514
Gene Name SGCD
Accession Number NM_000337
Gene ID 6444
Species Human
Product Type Lentivirus plasmid (overexpression)
Insert Length 873 bp
Gene Alias 35DAG,CMD1L,DAGD,SG-delta,SGCDP,SGD
Fluorescent Reporter ZsGreen
Mammalian Cell Selection Puromyocin
Fusion Tag 3xflag (C-Terminal)
Promoter CMV
Resistance Amplicin
ORF Nucleotide Sequence ATGATGCCTCAGGAGCAGTACACTCACCACCGGAGCACCATGCCTGGCTCTGTGGGGCCACAGGTATACAAGGTGGGGATTTATGGCTGGCGGAAACGATGCCTGTATTTCTTTGTCCTGCTCCTCATGATTTTAATACTGGTGAACTTGGCCATGACCATCTGGATTCTCAAAGTCATGAACTTCACAATTGATGGAATGGGAAACCTGAGGATCACAGAAAAAGGTCTAAAGCTAGAAGGAGACTCTGAATTCTTACAACCTCTCTACGCCAAAGAAATCCAGTCCCGACCAGGTAATGCCCTGTACTTCAAGTCTGCCAGAAATGTTACAGTGAACATTCTCAATGACCAGACTAAAGTGCTAACTCAGCTTATAACAGGTCCAAAAGCCGTAGAAGCTTATGGTAAAAAATTTGAGGTAAAAACTGTTTCTGGAAAATTGCTCTTCTCTGCAGACAATAATGAAGTGGTAGTAGGAGCTGAAAGATTACGAGTTTTAGGAGCGGAGGGCACAGTGTTCCCTAAATCTATAGAAACACCTAATGTCAGGGCAGACCCCTTCAAAGAACTAAGGTTGGAGTCCCCAACCCGGTCTCTAGTGATGGAGGCCCCAAAAGGAGTGGAAATCAATGCAGAAGCTGGCAATATGGAAGCCACCTGCAGGACAGAGCTGAGACTGGAATCCAAAGATGGAGAGATTAAGTTAGATGCTGCGAAAATCAGGCTACCTAGACTGCCTCATGGATCCTACACGCCTACAGGAACGAGGCAGAAGGTCTTCGAGATCTGCGTCTGCGCCAATGGGAGATTATTCCTGTCTCAGGCAGGAGCTGGGTCCACTTGTCAGATAAACACAAGTGTCTGCCTCTGA
ORF Protein Sequence MMPQEQYTHHRSTMPGSVGPQVYKVGIYGWRKRCLYFFVLLLMILILVNLAMTIWILKVMNFTIDGMGNLRITEKGLKLEGDSEFLQPLYAKEIQSRPGNALYFKSARNVTVNILNDQTKVLTQLITGPKAVEAYGKKFEVKTVSGKLLFSADNNEVVVGAERLRVLGAEGTVFPKSIETPNVRADPFKELRLESPTRSLVMEAPKGVEINAEAGNMEATCRTELRLESKDGEIKLDAAKIRLPRLPHGSYTPTGTRQKVFEICVCANGRLFLSQAGAGSTCQINTSVCL

Reference




    Data / case study


    Click to get more Data / Case study about the product.



    Associated products


    Category Cat No. Products Name
    Target Antibody GM-Tg-g-MP1511-Ab Anti-SGCD/ 35DAG/ CMD1L monoclonal antibody
    Target Antigen GM-Tg-g-MP1511-Ag SGCD VLP (virus-like particle)
    ORF Viral Vector pGMLP003514 Human SGCD Lentivirus plasmid
    ORF Viral Vector vGMLP003514 Human SGCD Lentivirus particle


    Target information

    Target ID GM-MP1511
    Target Name SGCD
    Gene ID 6444, 24052, 715190, 497892, 101089742, 612079, 517059, 100059936
    Gene Symbol and Synonyms 35DAG,A530047J11Rik,CMD1L,DAGD,delta-SG,LGMDR6,SG-delta,SGCD,SGCDP,SGD
    Uniprot Accession Q92629
    Uniprot Entry Name SGCD_HUMAN
    Protein Sub-location Transmembrane Protein
    Category Not Available
    Disease Not Available
    Gene Ensembl ENSG00000170624
    Target Classification Not Available

    The protein encoded by this gene is one of the four known components of the sarcoglycan complex, which is a subcomplex of the dystrophin-glycoprotein complex (DGC). DGC forms a link between the F-actin cytoskeleton and the extracellular matrix. This protein is expressed most abundantly in skeletal and cardiac muscle. Mutations in this gene have been associated with autosomal recessive limb-girdle muscular dystrophy and dilated cardiomyopathy. Alternatively spliced transcript variants encoding distinct isoforms have been observed for this gene. [provided by RefSeq, Jul 2008]



    About GMVC

    GDU

    GMVC (GM Vector Core) is GeneMedi’s unique platform for QbD Viral vectors Processes development and manufacturing. In GMVC, our core expertise lies in the tailored production of viral vectors, including adeno-associated virus (AAV), lentivirus, and adenovirus. Our state-of-the-art facilities are equipped for scalable manufacturing, ensuring high-quality viral vector production to meet both research and therapeutic needs. Our expert team specializes in process development, leveraging innovative technology and extensive industry knowledge to provide clients with tailored solutions that exceed expectations. GMVC will be the ideal partner for scientists and healthcare professionals seeking reliable and efficient viral vector production services.