Human PSTPIP2/MAYP ORF/cDNA clone-Lentivirus plasmid (NM_024430)

Cat. No.: pGMLP003550
Size: 10 µg
Concentration: generally 0.5ug/ul, usually not less than 0.3ug/ul
Leading Time: 3-7 working days

Pre-made Human PSTPIP2/MAYP Lentiviral expression plasmid for PSTPIP2 lentivirus packaging, PSTPIP2 lentivirus production, overexpression stable cell line development, cell transient transfection and gene delivery targeting T/B/NK cells, macrophages, cardiomyocytes, hepatocytes, and neurons.

Our GM-Lentiviral vector is seamlessly integrated with the GM lentivirus packaging system. Discover more about the GM lentivirus packaging system.


Target products collection

Go to PSTPIP2/MAYP products collection>>
(antibodies, antigen, VLP, mRNA, ORF viral vector, etc)

Purchase
Total Price: $581.4
Shipping fee: Limited-time free
For payment issues, contact us.


Product Description

Catalog ID pGMLP003550
Gene Name PSTPIP2
Accession Number NM_024430
Gene ID 9050
Species Human
Product Type Lentivirus plasmid (overexpression)
Insert Length 1005 bp
Gene Alias MAYP
Fluorescent Reporter ZsGreen
Mammalian Cell Selection Puromyocin
Fusion Tag 3xflag (C-Terminal)
Promoter CMV
Resistance Amplicin
ORF Nucleotide Sequence ATGACGCGCTCACTGTTCAAGGGAAACTTTTGGAGTGCAGACATCCTCAGCACCATCGGCTATGACAACATTATCCAACATCTGAACAATGGCCGCAAGAACTGCAAAGAGTTTGAAGACTTTCTAAAAGAAAGGGCAGCAATTGAAGAGAGGTATGGCAAAGATCTGCTCAACCTCTCTAGGAAGAAGCCGTGTGGACAGTCTGAAATCAACACCCTGAAGCGGGCCCTTGAAGTCTTCAAGCAGCAAGTAGACAATGTGGCACAATGTCACATTCAGCTTGCACAGAGTTTAAGAGAAGAGGCCAGGAAGATGGAAGAATTCAGGGAAAAGCAAAAACTACAACGAAAAAAGACAGAGCTCATAATGGATGCTATCCATAAACAAAAGAGCTTACAATTCAAGAAAACCATGGATGCAAAGAAGAACTATGAGCAGAAATGCCGGGACAAAGATGAGGCAGAACAGGCCGTCAGCCGGAGTGCCAACCTGGTGAACCCGAAGCAACAAGAAAAGCTTTTTGTGAAACTGGCAACTTCAAAGACCGCAGTAGAGGACTCAGACAAAGCATACATGCTGCACATCGGCACCCTGGATAAGGTCCGAGAAGAGTGGCAGAGTGAGCACATCAAGGCCTGCGAGGCATTTGAGGCTCAAGAATGTGAACGAATAAACTTCTTCCGGAATGCATTGTGGTTACATGTGAATCAGCTGTCACAACAATGTGTCACCAGTGATGAAATGTACGAACAAGTCCGAAAGAGTTTAGAAATGTGCAGCATTCAGAGGGACATTGAATACTTTGTGAATCAACGCAAAACTGGACAGATTCCACCAGCACCCATCATGTATGAGAATTTCTACTCCTCCCAGAAGAATGCAGTCCCAGCAGGAAAGGCTACAGGGCCTAACTTGGCAAGGAGAGGACCCCTCCCAATTCCTAAAAGCTCACCAGATGATCCCAATTACTCTTTGGTTGATGACTACAGTTTGCTCTATCAGTAA
ORF Protein Sequence MTRSLFKGNFWSADILSTIGYDNIIQHLNNGRKNCKEFEDFLKERAAIEERYGKDLLNLSRKKPCGQSEINTLKRALEVFKQQVDNVAQCHIQLAQSLREEARKMEEFREKQKLQRKKTELIMDAIHKQKSLQFKKTMDAKKNYEQKCRDKDEAEQAVSRSANLVNPKQQEKLFVKLATSKTAVEDSDKAYMLHIGTLDKVREEWQSEHIKACEAFEAQECERINFFRNALWLHVNQLSQQCVTSDEMYEQVRKSLEMCSIQRDIEYFVNQRKTGQIPPAPIMYENFYSSQKNAVPAGKATGPNLARRGPLPIPKSSPDDPNYSLVDDYSLLYQ

Reference




    Data / case study


    Click to get more Data / Case study about the product.



    Associated products


    Category Cat No. Products Name
    Target Antibody GM-Tg-g-MP2271-Ab Anti-PPIP2/ PSTPIP2/ MAYP monoclonal antibody
    Target Antigen GM-Tg-g-MP2271-Ag PSTPIP2 VLP (virus-like particle)
    ORF Viral Vector pGMLP003550 Human PSTPIP2 Lentivirus plasmid
    ORF Viral Vector pGMLV000993 Human PSTPIP2 Lentivirus plasmid
    ORF Viral Vector vGMLP003550 Human PSTPIP2 Lentivirus particle
    ORF Viral Vector vGMLV000993 Human PSTPIP2 Lentivirus particle


    Target information

    Target ID GM-MP2271
    Target Name PSTPIP2
    Gene ID 9050, 19201, 701032, 307248, 101085158, 480150, 523223, 100068770
    Gene Symbol and Synonyms cmo,MAYP,PSTPIP2,RGD1563090
    Uniprot Accession Q9H939
    Uniprot Entry Name PPIP2_HUMAN
    Protein Sub-location Transmembrane Protein
    Category Not Available
    Disease Not Available
    Gene Ensembl ENSG00000152229
    Target Classification Not Available

    Predicted to enable actin filament binding activity. Predicted to be involved in actin filament polymerization. Predicted to be located in cytoskeleton and membrane. Predicted to be active in actin filament; cytoplasm; and plasma membrane. [provided by Alliance of Genome Resources, Apr 2022]



    About GMVC

    GDU

    GMVC (GM Vector Core) is GeneMedi’s unique platform for QbD Viral vectors Processes development and manufacturing. In GMVC, our core expertise lies in the tailored production of viral vectors, including adeno-associated virus (AAV), lentivirus, and adenovirus. Our state-of-the-art facilities are equipped for scalable manufacturing, ensuring high-quality viral vector production to meet both research and therapeutic needs. Our expert team specializes in process development, leveraging innovative technology and extensive industry knowledge to provide clients with tailored solutions that exceed expectations. GMVC will be the ideal partner for scientists and healthcare professionals seeking reliable and efficient viral vector production services.