Human KCNK1/DPK/HOHO ORF/cDNA clone-Lentivirus plasmid (NM_002245)

Cat. No.: pGMLP003551
Size: 10 µg
Concentration: generally 0.5ug/ul, usually not less than 0.3ug/ul
Leading Time: 3-7 working days

Pre-made Human KCNK1/DPK/HOHO Lentiviral expression plasmid for KCNK1 lentivirus packaging, KCNK1 lentivirus production, overexpression stable cell line development, cell transient transfection and gene delivery targeting T/B/NK cells, macrophages, cardiomyocytes, hepatocytes, and neurons.

Our GM-Lentiviral vector is seamlessly integrated with the GM lentivirus packaging system. Discover more about the GM lentivirus packaging system.

pdf Datasheet
pdf MSDS
pdf Terms of Use
Target products collection

Go to KCNK1/DPK products collection>>
(antibodies, antigen, VLP, mRNA, ORF viral vector, etc)

Purchase
Total Price: $583.08
Shipping fee: Limited-time free
For payment issues, contact us.


Product Description

Catalog ID pGMLP003551
Gene Name KCNK1
Accession Number NM_002245
Gene ID 3775
Species Human
Product Type Lentivirus plasmid (overexpression)
Insert Length 1011 bp
Gene Alias DPK,HOHO,K2P1,K2p1.1,KCNO1,TWIK-1,TWIK1
Fluorescent Reporter ZsGreen
Mammalian Cell Selection Puromyocin
Fusion Tag 3xflag (C-Terminal)
Promoter CMV
Resistance Amplicin
ORF Nucleotide Sequence ATGCTGCAGTCCCTGGCCGGCAGCTCGTGCGTGCGCCTGGTGGAGCGGCACCGCTCGGCCTGGTGCTTCGGCTTCCTGGTGCTGGGCTACTTGCTCTACCTGGTCTTCGGCGCAGTGGTCTTCTCCTCGGTGGAGCTGCCCTATGAGGACCTGCTGCGCCAGGAGCTGCGCAAGCTGAAGCGACGCTTCTTGGAGGAGCACGAGTGCCTGTCTGAGCAGCAGCTGGAGCAGTTCCTGGGCCGGGTGCTGGAGGCCAGCAACTACGGCGTGTCGGTGCTCAGCAACGCCTCGGGCAACTGGAACTGGGACTTCACCTCCGCGCTCTTCTTCGCCAGCACCGTGCTCTCCACCACAGGTTATGGCCACACCGTGCCCTTGTCAGATGGAGGTAAGGCCTTCTGCATCATCTACTCCGTCATTGGCATTCCCTTCACCCTCCTGTTCCTGACGGCTGTGGTCCAGCGCATCACCGTGCACGTCACCCGCAGGCCGGTCCTCTACTTCCACATCCGCTGGGGCTTCTCCAAGCAGGTGGTGGCCATCGTCCATGCCGTGCTCCTTGGGTTTGTCACTGTGTCCTGCTTCTTCTTCATCCCGGCCGCTGTCTTCTCAGTCCTGGAGGATGACTGGAACTTCCTGGAATCCTTTTATTTTTGTTTTATTTCCCTGAGCACCATTGGCCTGGGGGATTATGTGCCTGGGGAAGGCTACAATCAAAAATTCAGAGAGCTCTATAAGATTGGGATCACGTGTTACCTGCTACTTGGCCTTATTGCCATGTTGGTAGTTCTGGAAACCTTCTGTGAACTCCATGAGCTGAAAAAATTCAGAAAAATGTTCTATGTGAAGAAGGACAAGGACGAGGATCAGGTGCACATCATAGAGCATGACCAACTGTCCTTCTCCTCGATCACAGACCAGGCAGCTGGCATGAAAGAGGACCAGAAGCAAAATGAGCCTTTTGTGGCCACCCAGTCATCTGCCTGCGTGGATGGCCCTGCAAACCATTGA
ORF Protein Sequence MLQSLAGSSCVRLVERHRSAWCFGFLVLGYLLYLVFGAVVFSSVELPYEDLLRQELRKLKRRFLEEHECLSEQQLEQFLGRVLEASNYGVSVLSNASGNWNWDFTSALFFASTVLSTTGYGHTVPLSDGGKAFCIIYSVIGIPFTLLFLTAVVQRITVHVTRRPVLYFHIRWGFSKQVVAIVHAVLLGFVTVSCFFFIPAAVFSVLEDDWNFLESFYFCFISLSTIGLGDYVPGEGYNQKFRELYKIGITCYLLLGLIAMLVVLETFCELHELKKFRKMFYVKKDKDEDQVHIIEHDQLSFSSITDQAAGMKEDQKQNEPFVATQSSACVDGPANH

Reference




    Data / case study


    Click to get more Data / Case study about the product.



    Associated products


    Category Cat No. Products Name
    Target Antibody GM-Tg-g-MP0677-Ab Anti-KCNK1/ DPK/ HOHO monoclonal antibody
    Target Antigen GM-Tg-g-MP0677-Ag KCNK1 VLP (virus-like particle)
    ORF Viral Vector pGMLP003551 Human KCNK1 Lentivirus plasmid
    ORF Viral Vector vGMLP003551 Human KCNK1 Lentivirus particle


    Target information

    Target ID GM-MP0677
    Target Name KCNK1
    Gene ID 3775, 16525, 718815, 59324, 101087524, 488965, 505563, 100059489
    Gene Symbol and Synonyms DPK,HOHO,K2P1,K2p1.1,KCNK1,KCNO1,Twik,TWIK-1,TWIK1
    Uniprot Accession O00180
    Uniprot Entry Name KCNK1_HUMAN
    Protein Sub-location Transmembrane Protein
    Category Not Available
    Disease Not Available
    Gene Ensembl ENSG00000135750
    Target Classification Not Available

    This gene encodes one of the members of the superfamily of potassium channel proteins containing two pore-forming P domains. The product of this gene has not been shown to be a functional channel, however, it may require other non-pore-forming proteins for activity. [provided by RefSeq, Jul 2008]



    About GMVC

    GDU

    GMVC (GM Vector Core) is GeneMedi’s unique platform for QbD Viral vectors Processes development and manufacturing. In GMVC, our core expertise lies in the tailored production of viral vectors, including adeno-associated virus (AAV), lentivirus, and adenovirus. Our state-of-the-art facilities are equipped for scalable manufacturing, ensuring high-quality viral vector production to meet both research and therapeutic needs. Our expert team specializes in process development, leveraging innovative technology and extensive industry knowledge to provide clients with tailored solutions that exceed expectations. GMVC will be the ideal partner for scientists and healthcare professionals seeking reliable and efficient viral vector production services.