Human G6PC3/SCN4/UGRP ORF/cDNA clone-Lentivirus plasmid (NM_138387)
Cat. No.: pGMLP003565
Size: 10 µg
Concentration: generally 0.5ug/ul, usually not less than 0.3ug/ul
Leading Time: 3-7 working days
Pre-made Human G6PC3/SCN4/UGRP Lentiviral expression plasmid for G6PC3 lentivirus packaging, G6PC3 lentivirus production, overexpression stable cell line development, cell transient transfection and gene delivery targeting T/B/NK cells, macrophages, cardiomyocytes, hepatocytes, and neurons.
Our GM-Lentiviral vector is seamlessly integrated with the GM lentivirus packaging system. Discover more about the GM lentivirus packaging system.
Go to
G6PC3/SCN4 products
collection>>
(antibodies,
antigen, VLP, mRNA, ORF viral vector, etc)
Product Description
Catalog ID | pGMLP003565 |
Gene Name | G6PC3 |
Accession Number | NM_138387 |
Gene ID | 92579 |
Species | Human |
Product Type | Lentivirus plasmid (overexpression) |
Insert Length | 1041 bp |
Gene Alias | SCN4,UGRP |
Fluorescent Reporter | ZsGreen |
Mammalian Cell Selection | Puromyocin |
Fusion Tag | 3xflag (C-Terminal) |
Promoter | CMV |
Resistance | Amplicin |
ORF Nucleotide Sequence | ATGGAGTCCACGCTGGGCGCGGGCATCGTGATAGCCGAGGCGCTACAGAACCAGCTAGCCTGGCTGGAGAACGTGTGGCTCTGGATCACCTTTCTGGGCGATCCCAAGATCCTCTTTCTGTTCTACTTCCCCGCGGCCTACTACGCCTCCCGCCGTGTGGGCATCGCGGTGCTCTGGATCAGCCTCATCACCGAGTGGCTCAACCTCATCTTCAAGTGGTTTCTTTTTGGAGACAGGCCCTTTTGGTGGGTCCATGAGTCTGGTTACTACAGCCAGGCTCCAGCCCAGGTTCACCAGTTCCCCTCTTCTTGTGAGACTGGTCCAGGCAGCCCTTCTGGACACTGCATGATCACAGGAGCAGCCCTCTGGCCCATAATGACGGCCCTGTCTTCGCAGGTGGCCACTCGGGCCCGCAGCCGCTGGGTAAGGGTGATGCCTAGCCTGGCTTATTGCACCTTCCTTTTGGCGGTTGGCTTGTCGCGAATCTTCATCTTAGCACATTTCCCTCACCAGGTGCTGGCTGGCCTAATAACTGGCGCTGTCCTGGGCTGGCTGATGACTCCCCGAGTGCCTATGGAGCGGGAGCTAAGCTTCTATGGGTTGACTGCACTGGCCCTCATGCTAGGCACCAGCCTCATCTATTGGACCCTCTTTACACTGGGCCTGGATCTTTCTTGGTCCATCAGCCTAGCCTTCAAGTGGTGTGAGCGGCCTGAGTGGATACACGTGGATAGCCGGCCCTTTGCCTCCCTGAGCCGTGACTCAGGGGCTGCCCTGGGCCTGGGCATTGCCTTGCACTCTCCCTGCTATGCCCAGGTGCGTCGGGCACAGCTGGGAAATGGCCAGAAGATAGCCTGCCTTGTGCTGGCCATGGGGCTGCTGGGCCCCCTGGACTGGCTGGGCCACCCCCCTCAGATCAGCCTCTTCTACATTTTCAATTTCCTCAAGTACACCCTCTGGCCATGCCTAGTCCTGGCCCTCGTGCCCTGGGCAGTGCACATGTTCAGTGCCCAGGAAGCACCGCCCATCCACTCTTCCTGA |
ORF Protein Sequence | MESTLGAGIVIAEALQNQLAWLENVWLWITFLGDPKILFLFYFPAAYYASRRVGIAVLWISLITEWLNLIFKWFLFGDRPFWWVHESGYYSQAPAQVHQFPSSCETGPGSPSGHCMITGAALWPIMTALSSQVATRARSRWVRVMPSLAYCTFLLAVGLSRIFILAHFPHQVLAGLITGAVLGWLMTPRVPMERELSFYGLTALALMLGTSLIYWTLFTLGLDLSWSISLAFKWCERPEWIHVDSRPFASLSRDSGAALGLGIALHSPCYAQVRRAQLGNGQKIACLVLAMGLLGPLDWLGHPPQISLFYIFNFLKYTLWPCLVLALVPWAVHMFSAQEAPPIHSS |
Reference
Data / case study
Click to get more Data / Case study about the product.
Associated products
Category | Cat No. | Products Name |
---|---|---|
Target Antibody | GM-Tg-g-IP0877-Ab | Anti-G6PC3 monoclonal antibody |
Target Antigen | GM-Tg-g-IP0877-Ag | G6PC3 protein |
ORF Viral Vector | pGMLP003565 | Human G6PC3 Lentivirus plasmid |
ORF Viral Vector | vGMLP003565 | Human G6PC3 Lentivirus particle |
Target information
Target ID | GM-IP0877 |
Target Name | G6PC3 |
Gene ID | 92579, 68401, 714276, 303565, 101097770, 490942, 369023, 100064862 |
Gene Symbol and Synonyms | 0710001K01Rik,G6PC3,SCN4,UGRP |
Uniprot Accession | Q9BUM1 |
Uniprot Entry Name | G6PC3_HUMAN |
Protein Sub-location | Introcelluar Protein |
Category | Not Available |
Disease | Not Available |
Gene Ensembl | ENSG00000141349 |
Target Classification | Not Available |
This gene encodes the catalytic subunit of glucose-6-phosphatase (G6Pase). G6Pase is located in the endoplasmic reticulum (ER) and catalyzes the hydrolysis of glucose-6-phosphate to glucose and phosphate in the last step of the gluconeogenic and glycogenolytic pathways. Mutations in this gene result in autosomal recessive severe congenital neutropenia. Alternative splicing results in multiple transcript variants. [provided by RefSeq, Feb 2016]
About GMVC
GMVC (GM Vector Core) is GeneMedi’s unique platform for QbD Viral vectors Processes development and manufacturing. In GMVC, our core expertise lies in the tailored production of viral vectors, including adeno-associated virus (AAV), lentivirus, and adenovirus. Our state-of-the-art facilities are equipped for scalable manufacturing, ensuring high-quality viral vector production to meet both research and therapeutic needs. Our expert team specializes in process development, leveraging innovative technology and extensive industry knowledge to provide clients with tailored solutions that exceed expectations. GMVC will be the ideal partner for scientists and healthcare professionals seeking reliable and efficient viral vector production services.