Human G6PC3/SCN4/UGRP ORF/cDNA clone-Lentivirus particle (NM_138387)
Cat. No.: vGMLP003565
Pre-made Human G6PC3/SCN4/UGRP Lentiviral expression plasmid for G6PC3 lentivirus packaging, G6PC3 lentivirus production, overexpression stable cell line development, cell transient transfection and gene delivery targeting T/B/NK cells, macrophages, cardiomyocytes, hepatocytes, and neurons.
The GM Vector Core (GMVC) specializes in custom lentivirus development and offers a range of lentivirus manufacturing solutions, leveraging state-of-the-art processes. Learn more about our services.
Go to
G6PC3/SCN4 products
collection>>
(antibodies,
antigen, VLP, mRNA, ORF viral vector, etc)
| Catalog No. | Product Name | lentivirus Grade | lentivirus quantity |
|---|---|---|---|
| vGMLP003565 | Human G6PC3 Lentivirus particle | Pilot Grade | 1.0E+8TU |
| 5.0E+8TU | |||
| 1.0E+9TU | |||
| Research Grade | 1.0E+8TU | ||
| 5.0E+8TU | |||
| 1.0E+9TU | |||
| GMP-like Grade | inquiry | ||
| GMP Grade | inquiry |
Product Description
| Catalog ID | vGMLP003565 |
| Gene Name | G6PC3 |
| Accession Number | NM_138387 |
| Gene ID | 92579 |
| Species | Human |
| Product Type | Lentivirus particle (overexpression) |
| Insert Length | 1041 bp |
| Gene Alias | SCN4,UGRP |
| Fluorescent Reporter | ZsGreen |
| Mammalian Cell Selection | Puromyocin |
| Fusion Tag | 3xflag (C-Terminal) |
| Promoter | CMV |
| Resistance | Amplicin |
| ORF Nucleotide Sequence | ATGGAGTCCACGCTGGGCGCGGGCATCGTGATAGCCGAGGCGCTACAGAACCAGCTAGCCTGGCTGGAGAACGTGTGGCTCTGGATCACCTTTCTGGGCGATCCCAAGATCCTCTTTCTGTTCTACTTCCCCGCGGCCTACTACGCCTCCCGCCGTGTGGGCATCGCGGTGCTCTGGATCAGCCTCATCACCGAGTGGCTCAACCTCATCTTCAAGTGGTTTCTTTTTGGAGACAGGCCCTTTTGGTGGGTCCATGAGTCTGGTTACTACAGCCAGGCTCCAGCCCAGGTTCACCAGTTCCCCTCTTCTTGTGAGACTGGTCCAGGCAGCCCTTCTGGACACTGCATGATCACAGGAGCAGCCCTCTGGCCCATAATGACGGCCCTGTCTTCGCAGGTGGCCACTCGGGCCCGCAGCCGCTGGGTAAGGGTGATGCCTAGCCTGGCTTATTGCACCTTCCTTTTGGCGGTTGGCTTGTCGCGAATCTTCATCTTAGCACATTTCCCTCACCAGGTGCTGGCTGGCCTAATAACTGGCGCTGTCCTGGGCTGGCTGATGACTCCCCGAGTGCCTATGGAGCGGGAGCTAAGCTTCTATGGGTTGACTGCACTGGCCCTCATGCTAGGCACCAGCCTCATCTATTGGACCCTCTTTACACTGGGCCTGGATCTTTCTTGGTCCATCAGCCTAGCCTTCAAGTGGTGTGAGCGGCCTGAGTGGATACACGTGGATAGCCGGCCCTTTGCCTCCCTGAGCCGTGACTCAGGGGCTGCCCTGGGCCTGGGCATTGCCTTGCACTCTCCCTGCTATGCCCAGGTGCGTCGGGCACAGCTGGGAAATGGCCAGAAGATAGCCTGCCTTGTGCTGGCCATGGGGCTGCTGGGCCCCCTGGACTGGCTGGGCCACCCCCCTCAGATCAGCCTCTTCTACATTTTCAATTTCCTCAAGTACACCCTCTGGCCATGCCTAGTCCTGGCCCTCGTGCCCTGGGCAGTGCACATGTTCAGTGCCCAGGAAGCACCGCCCATCCACTCTTCCTGA |
| ORF Protein Sequence | MESTLGAGIVIAEALQNQLAWLENVWLWITFLGDPKILFLFYFPAAYYASRRVGIAVLWISLITEWLNLIFKWFLFGDRPFWWVHESGYYSQAPAQVHQFPSSCETGPGSPSGHCMITGAALWPIMTALSSQVATRARSRWVRVMPSLAYCTFLLAVGLSRIFILAHFPHQVLAGLITGAVLGWLMTPRVPMERELSFYGLTALALMLGTSLIYWTLFTLGLDLSWSISLAFKWCERPEWIHVDSRPFASLSRDSGAALGLGIALHSPCYAQVRRAQLGNGQKIACLVLAMGLLGPLDWLGHPPQISLFYIFNFLKYTLWPCLVLALVPWAVHMFSAQEAPPIHSS |
Reference
Data / case study
Click to get more Data / Case study about the product.
Associated products
| Category | Cat No. | Products Name |
|---|---|---|
| Target Antibody | GM-Tg-g-IP0877-Ab | Anti-G6PC3 monoclonal antibody |
| Target Antigen | GM-Tg-g-IP0877-Ag | G6PC3 protein |
| ORF Viral Vector | pGMLP003565 | Human G6PC3 Lentivirus plasmid |
| ORF Viral Vector | vGMLP003565 | Human G6PC3 Lentivirus particle |
Target information
| Target ID | GM-IP0877 |
| Target Name | G6PC3 |
| Gene ID | 92579, 68401, 714276, 303565, 101097770, 490942, 369023, 100064862 |
| Gene Symbol and Synonyms | 0710001K01Rik,G6PC3,SCN4,UGRP |
| Uniprot Accession | Q9BUM1 |
| Uniprot Entry Name | G6PC3_HUMAN |
| Protein Sub-location | Introcelluar Protein |
| Category | Not Available |
| Disease | Not Available |
| Gene Ensembl | ENSG00000141349 |
| Target Classification | Not Available |
This gene encodes the catalytic subunit of glucose-6-phosphatase (G6Pase). G6Pase is located in the endoplasmic reticulum (ER) and catalyzes the hydrolysis of glucose-6-phosphate to glucose and phosphate in the last step of the gluconeogenic and glycogenolytic pathways. Mutations in this gene result in autosomal recessive severe congenital neutropenia. Alternative splicing results in multiple transcript variants. [provided by RefSeq, Feb 2016]
About GMVC

GMVC (GM Vector Core) is GeneMedi’s unique platform for QbD Viral vectors Processes development and manufacturing. In GMVC, our core expertise lies in the tailored production of viral vectors, including adeno-associated virus (AAV), lentivirus, and adenovirus. Our state-of-the-art facilities are equipped for scalable manufacturing, ensuring high-quality viral vector production to meet both research and therapeutic needs. Our expert team specializes in process development, leveraging innovative technology and extensive industry knowledge to provide clients with tailored solutions that exceed expectations. GMVC will be the ideal partner for scientists and healthcare professionals seeking reliable and efficient viral vector production services.


