Human G6PC3/SCN4/UGRP ORF/cDNA clone-Lentivirus particle (NM_138387)

Cat. No.: vGMLP003565

Pre-made Human G6PC3/SCN4/UGRP Lentiviral expression plasmid for G6PC3 lentivirus packaging, G6PC3 lentivirus production, overexpression stable cell line development, cell transient transfection and gene delivery targeting T/B/NK cells, macrophages, cardiomyocytes, hepatocytes, and neurons.

The GM Vector Core (GMVC) specializes in custom lentivirus development and offers a range of lentivirus manufacturing solutions, leveraging state-of-the-art processes. Learn more about our services.

Target products collection

Go to G6PC3/SCN4 products collection>>
(antibodies, antigen, VLP, mRNA, ORF viral vector, etc)

Product information

Catalog No. Product Name lentivirus Grade lentivirus quantity
vGMLP003565 Human G6PC3 Lentivirus particle Pilot Grade 1.0E+8TU
5.0E+8TU
1.0E+9TU
Research Grade 1.0E+8TU
5.0E+8TU
1.0E+9TU
GMP-like Grade inquiry
GMP Grade inquiry


Product Description

Catalog ID vGMLP003565
Gene Name G6PC3
Accession Number NM_138387
Gene ID 92579
Species Human
Product Type Lentivirus particle (overexpression)
Insert Length 1041 bp
Gene Alias SCN4,UGRP
Fluorescent Reporter ZsGreen
Mammalian Cell Selection Puromyocin
Fusion Tag 3xflag (C-Terminal)
Promoter CMV
Resistance Amplicin
ORF Nucleotide Sequence ATGGAGTCCACGCTGGGCGCGGGCATCGTGATAGCCGAGGCGCTACAGAACCAGCTAGCCTGGCTGGAGAACGTGTGGCTCTGGATCACCTTTCTGGGCGATCCCAAGATCCTCTTTCTGTTCTACTTCCCCGCGGCCTACTACGCCTCCCGCCGTGTGGGCATCGCGGTGCTCTGGATCAGCCTCATCACCGAGTGGCTCAACCTCATCTTCAAGTGGTTTCTTTTTGGAGACAGGCCCTTTTGGTGGGTCCATGAGTCTGGTTACTACAGCCAGGCTCCAGCCCAGGTTCACCAGTTCCCCTCTTCTTGTGAGACTGGTCCAGGCAGCCCTTCTGGACACTGCATGATCACAGGAGCAGCCCTCTGGCCCATAATGACGGCCCTGTCTTCGCAGGTGGCCACTCGGGCCCGCAGCCGCTGGGTAAGGGTGATGCCTAGCCTGGCTTATTGCACCTTCCTTTTGGCGGTTGGCTTGTCGCGAATCTTCATCTTAGCACATTTCCCTCACCAGGTGCTGGCTGGCCTAATAACTGGCGCTGTCCTGGGCTGGCTGATGACTCCCCGAGTGCCTATGGAGCGGGAGCTAAGCTTCTATGGGTTGACTGCACTGGCCCTCATGCTAGGCACCAGCCTCATCTATTGGACCCTCTTTACACTGGGCCTGGATCTTTCTTGGTCCATCAGCCTAGCCTTCAAGTGGTGTGAGCGGCCTGAGTGGATACACGTGGATAGCCGGCCCTTTGCCTCCCTGAGCCGTGACTCAGGGGCTGCCCTGGGCCTGGGCATTGCCTTGCACTCTCCCTGCTATGCCCAGGTGCGTCGGGCACAGCTGGGAAATGGCCAGAAGATAGCCTGCCTTGTGCTGGCCATGGGGCTGCTGGGCCCCCTGGACTGGCTGGGCCACCCCCCTCAGATCAGCCTCTTCTACATTTTCAATTTCCTCAAGTACACCCTCTGGCCATGCCTAGTCCTGGCCCTCGTGCCCTGGGCAGTGCACATGTTCAGTGCCCAGGAAGCACCGCCCATCCACTCTTCCTGA
ORF Protein Sequence MESTLGAGIVIAEALQNQLAWLENVWLWITFLGDPKILFLFYFPAAYYASRRVGIAVLWISLITEWLNLIFKWFLFGDRPFWWVHESGYYSQAPAQVHQFPSSCETGPGSPSGHCMITGAALWPIMTALSSQVATRARSRWVRVMPSLAYCTFLLAVGLSRIFILAHFPHQVLAGLITGAVLGWLMTPRVPMERELSFYGLTALALMLGTSLIYWTLFTLGLDLSWSISLAFKWCERPEWIHVDSRPFASLSRDSGAALGLGIALHSPCYAQVRRAQLGNGQKIACLVLAMGLLGPLDWLGHPPQISLFYIFNFLKYTLWPCLVLALVPWAVHMFSAQEAPPIHSS

Reference




    Data / case study


    Click to get more Data / Case study about the product.



    Associated products


    Category Cat No. Products Name
    Target Antibody GM-Tg-g-IP0877-Ab Anti-G6PC3 monoclonal antibody
    Target Antigen GM-Tg-g-IP0877-Ag G6PC3 protein
    ORF Viral Vector pGMLP003565 Human G6PC3 Lentivirus plasmid
    ORF Viral Vector vGMLP003565 Human G6PC3 Lentivirus particle


    Target information

    Target ID GM-IP0877
    Target Name G6PC3
    Gene ID 92579, 68401, 714276, 303565, 101097770, 490942, 369023, 100064862
    Gene Symbol and Synonyms 0710001K01Rik,G6PC3,SCN4,UGRP
    Uniprot Accession Q9BUM1
    Uniprot Entry Name G6PC3_HUMAN
    Protein Sub-location Introcelluar Protein
    Category Not Available
    Disease Not Available
    Gene Ensembl ENSG00000141349
    Target Classification Not Available

    This gene encodes the catalytic subunit of glucose-6-phosphatase (G6Pase). G6Pase is located in the endoplasmic reticulum (ER) and catalyzes the hydrolysis of glucose-6-phosphate to glucose and phosphate in the last step of the gluconeogenic and glycogenolytic pathways. Mutations in this gene result in autosomal recessive severe congenital neutropenia. Alternative splicing results in multiple transcript variants. [provided by RefSeq, Feb 2016]



    About GMVC

    GDU

    GMVC (GM Vector Core) is GeneMedi’s unique platform for QbD Viral vectors Processes development and manufacturing. In GMVC, our core expertise lies in the tailored production of viral vectors, including adeno-associated virus (AAV), lentivirus, and adenovirus. Our state-of-the-art facilities are equipped for scalable manufacturing, ensuring high-quality viral vector production to meet both research and therapeutic needs. Our expert team specializes in process development, leveraging innovative technology and extensive industry knowledge to provide clients with tailored solutions that exceed expectations. GMVC will be the ideal partner for scientists and healthcare professionals seeking reliable and efficient viral vector production services.