Human RAD51C/BROVCA3/FANCO ORF/cDNA clone-Lentivirus plasmid (NM_058216)

Cat. No.: pGMLP003608
Size: 10 µg
Concentration: generally 0.5ug/ul, usually not less than 0.3ug/ul
Leading Time: 3-7 working days

Pre-made Human RAD51C/BROVCA3/FANCO Lentiviral expression plasmid for RAD51C lentivirus packaging, RAD51C lentivirus production, overexpression stable cell line development, cell transient transfection and gene delivery targeting T/B/NK cells, macrophages, cardiomyocytes, hepatocytes, and neurons.

Our GM-Lentiviral vector is seamlessly integrated with the GM lentivirus packaging system. Discover more about the GM lentivirus packaging system.

pdf Datasheet
pdf MSDS
pdf Terms of Use
Target products collection

Go to RAD51C/BROVCA3 products collection>>
(antibodies, antigen, VLP, mRNA, ORF viral vector, etc)

Purchase
Total Price: $616.68
Shipping fee: Limited-time free
For payment issues, contact us.


Product Description

Catalog ID pGMLP003608
Gene Name RAD51C
Accession Number NM_058216
Gene ID 5889
Species Human
Product Type Lentivirus plasmid (overexpression)
Insert Length 1131 bp
Gene Alias BROVCA3,FANCO,R51H3,RAD51L2
Fluorescent Reporter ZsGreen
Mammalian Cell Selection Puromyocin
Fusion Tag 3xflag (C-Terminal)
Promoter CMV
Resistance Amplicin
ORF Nucleotide Sequence ATGCGCGGGAAGACGTTCCGCTTTGAAATGCAGCGGGATTTGGTGAGTTTCCCGCTGTCTCCAGCGGTGCGGGTGAAGCTGGTGTCTGCGGGGTTCCAGACTGCTGAGGAACTCCTAGAGGTGAAACCCTCCGAGCTTAGCAAAGAAGTTGGGATATCTAAAGCAGAAGCCTTAGAAACTCTGCAAATTATCAGAAGAGAATGTCTCACAAATAAACCAAGATATGCTGGTACATCTGAGTCACACAAGAAGTGTACAGCACTGGAACTTCTTGAGCAGGAGCATACCCAGGGCTTCATAATCACCTTCTGTTCAGCACTAGATGATATTCTTGGGGGTGGAGTGCCCTTAATGAAAACAACAGAAATTTGTGGTGCACCAGGTGTTGGAAAAACACAATTATGTATGCAGTTGGCAGTAGATGTGCAGATACCAGAATGTTTTGGAGGAGTGGCAGGTGAAGCAGTTTTTATTGATACAGAGGGAAGTTTTATGGTTGATAGAGTGGTAGACCTTGCTACTGCCTGCATTCAGCACCTTCAGCTTATAGCAGAAAAACACAAGGGAGAGGAACACCGAAAAGCTTTGGAGGATTTCACTCTTGATAATATTCTTTCTCATATTTATTATTTTCGCTGTCGTGACTACACAGAGTTACTGGCACAAGTTTATCTTCTTCCAGATTTCCTTTCAGAACACTCAAAGGTTCGACTAGTGATAGTGGATGGTATTGCTTTTCCATTTCGTCATGACCTAGATGACCTGTCTCTTCGTACTCGGTTATTAAATGGCCTAGCCCAGCAAATGATCAGCCTTGCAAATAATCACAGATTAGCTGTAATTTTAACCAATCAGATGACAACAAAGATTGATAGAAATCAGGCCTTGCTTGTTCCTGCATTAGGGGAAAGTTGGGGACATGCTGCTACAATACGGCTAATCTTTCATTGGGACCGAAAGCAAAGGTTGGCAACATTGTACAAGTCACCCAGCCAGAAGGAATGCACAGTACTGTTTCAAATCAAACCTCAGGGATTTAGAGATACTGTTGTTACTTCTGCATGTTCATTGCAAACAGAAGGTTCCTTGAGCACCCGGAAACGGTCACGAGACCCAGAGGAAGAATTATAA
ORF Protein Sequence MRGKTFRFEMQRDLVSFPLSPAVRVKLVSAGFQTAEELLEVKPSELSKEVGISKAEALETLQIIRRECLTNKPRYAGTSESHKKCTALELLEQEHTQGFIITFCSALDDILGGGVPLMKTTEICGAPGVGKTQLCMQLAVDVQIPECFGGVAGEAVFIDTEGSFMVDRVVDLATACIQHLQLIAEKHKGEEHRKALEDFTLDNILSHIYYFRCRDYTELLAQVYLLPDFLSEHSKVRLVIVDGIAFPFRHDLDDLSLRTRLLNGLAQQMISLANNHRLAVILTNQMTTKIDRNQALLVPALGESWGHAATIRLIFHWDRKQRLATLYKSPSQKECTVLFQIKPQGFRDTVVTSACSLQTEGSLSTRKRSRDPEEEL

Reference




    Data / case study


    Click to get more Data / Case study about the product.



    Associated products


    Category Cat No. Products Name
    Target Antibody GM-Tg-g-IP2689-Ab Anti-RAD51C monoclonal antibody
    Target Antigen GM-Tg-g-IP2689-Ag RAD51C protein
    ORF Viral Vector pGMLP003608 Human RAD51C Lentivirus plasmid
    ORF Viral Vector pGMPC000651 Human RAD51C Mammalian (Non-Viral Vector) plasmid
    ORF Viral Vector vGMLP003608 Human RAD51C Lentivirus particle


    Target information

    Target ID GM-IP2689
    Target Name RAD51C
    Gene ID 5889, 114714, 714828, 497976, 101096020, 480573, 540886, 100070966
    Gene Symbol and Synonyms BROVCA3,FANCO,R51H3,RAD51C,RAD51L2,RGD1563765
    Uniprot Accession O43502
    Uniprot Entry Name RA51C_HUMAN
    Protein Sub-location Introcelluar Protein
    Category Not Available
    Disease Cancer
    Gene Ensembl ENSG00000108384
    Target Classification Tumor-associated antigen (TAA)

    This gene is a member of the RAD51 family. RAD51 family members are highly similar to bacterial RecA and Saccharomyces cerevisiae Rad51 and are known to be involved in the homologous recombination and repair of DNA. This protein can interact with other RAD51 paralogs and is reported to be important for Holliday junction resolution. Mutations in this gene are associated with Fanconi anemia-like syndrome. This gene is one of four localized to a region of chromosome 17q23 where amplification occurs frequently in breast tumors. Overexpression of the four genes during amplification has been observed and suggests a possible role in tumor progression. Alternative splicing results in multiple transcript variants. [provided by RefSeq, Jul 2013]



    About GMVC

    GDU

    GMVC (GM Vector Core) is GeneMedi’s unique platform for QbD Viral vectors Processes development and manufacturing. In GMVC, our core expertise lies in the tailored production of viral vectors, including adeno-associated virus (AAV), lentivirus, and adenovirus. Our state-of-the-art facilities are equipped for scalable manufacturing, ensuring high-quality viral vector production to meet both research and therapeutic needs. Our expert team specializes in process development, leveraging innovative technology and extensive industry knowledge to provide clients with tailored solutions that exceed expectations. GMVC will be the ideal partner for scientists and healthcare professionals seeking reliable and efficient viral vector production services.