Human GRPR/BB2/BB2R ORF/cDNA clone-Lentivirus plasmid (NM_005314)

Cat. No.: pGMLP003622
Size: 10 µg
Concentration: generally 0.5ug/ul, usually not less than 0.3ug/ul
Leading Time: 3-7 working days

Pre-made Human GRPR/BB2/BB2R Lentiviral expression plasmid for GRPR lentivirus packaging, GRPR lentivirus production, overexpression stable cell line development, cell transient transfection and gene delivery targeting T/B/NK cells, macrophages, cardiomyocytes, hepatocytes, and neurons.

Our GM-Lentiviral vector is seamlessly integrated with the GM lentivirus packaging system. Discover more about the GM lentivirus packaging system.


Target products collection

Go to GRPR/BB2 products collection>>
(antibodies, antigen, VLP, mRNA, ORF viral vector, etc)

Purchase
Total Price: $623.4
Shipping fee: Limited-time free
For payment issues, contact us.


Product Description

Catalog ID pGMLP003622
Gene Name GRPR
Accession Number NM_005314
Gene ID 2925
Species Human
Product Type Lentivirus plasmid (overexpression)
Insert Length 1155 bp
Gene Alias BB2,BB2R
Fluorescent Reporter ZsGreen
Mammalian Cell Selection Puromyocin
Fusion Tag 3xflag (C-Terminal)
Promoter CMV
Resistance Amplicin
ORF Nucleotide Sequence ATGGCTCTAAATGACTGTTTCCTTCTGAACTTGGAGGTGGACCATTTCATGCACTGCAACATCTCCAGTCACAGTGCGGATCTCCCCGTGAACGATGACTGGTCCCACCCGGGGATCCTCTATGTCATCCCTGCAGTTTATGGGGTTATCATTCTGATAGGCCTCATTGGCAACATCACTTTGATCAAGATCTTCTGTACAGTCAAGTCCATGCGAAACGTTCCAAACCTGTTCATTTCCAGTCTGGCTTTGGGAGACCTGCTCCTCCTAATAACGTGTGCTCCAGTGGATGCCAGCAGGTACCTGGCTGACAGATGGCTATTTGGCAGGATTGGCTGCAAACTGATCCCCTTTATACAGCTTACCTCTGTTGGGGTGTCTGTCTTCACACTCACGGCGCTCTCGGCAGACAGATACAAAGCCATTGTCCGGCCAATGGATATCCAGGCCTCTCATGCCCTGATGAAGATCTGCCTCAAAGCCGCCTTTATCTGGATCATCTCCATGCTGCTGGCCATTCCAGAGGCCGTGTTTTCTGACCTCCATCCCTTCCATGAGGAAAGCACCAACCAGACCTTCATTAGCTGTGCCCCATACCCACACTCTAATGAGCTTCACCCCAAAATCCATTCTATGGCTTCCTTTCTGGTCTTCTACGTCATTCCACTGTCGATCATCTCTGTTTACTACTACTTCATTGCTAAAAATCTGATCCAGAGTGCTTACAATCTTCCCGTGGAAGGGAATATACATGTCAAGAAGCAGATTGAATCCCGGAAGCGACTTGCCAAGACAGTGCTGGTGTTTGTGGGCCTGTTCGCCTTCTGCTGGCTCCCCAATCATGTCATCTACCTGTACCGCTCCTACCACTACTCTGAGGTGGACACCTCCATGCTCCACTTTGTCACCAGCATCTGTGCCCGCCTCCTGGCCTTCACCAACTCCTGCGTGAACCCCTTTGCCCTCTACCTGCTGAGCAAGAGTTTCAGGAAACAGTTCAACACTCAGCTGCTCTGTTGCCAGCCTGGCCTGATCATCCGGTCTCACAGCACTGGAAGGAGTACAACCTGCATGACCTCCCTCAAGAGTACCAACCCCTCCGTGGCCACCTTTAGCCTCATCAATGGAAACATCTGTCACGAGCGGTATGTCTAG
ORF Protein Sequence MALNDCFLLNLEVDHFMHCNISSHSADLPVNDDWSHPGILYVIPAVYGVIILIGLIGNITLIKIFCTVKSMRNVPNLFISSLALGDLLLLITCAPVDASRYLADRWLFGRIGCKLIPFIQLTSVGVSVFTLTALSADRYKAIVRPMDIQASHALMKICLKAAFIWIISMLLAIPEAVFSDLHPFHEESTNQTFISCAPYPHSNELHPKIHSMASFLVFYVIPLSIISVYYYFIAKNLIQSAYNLPVEGNIHVKKQIESRKRLAKTVLVFVGLFAFCWLPNHVIYLYRSYHYSEVDTSMLHFVTSICARLLAFTNSCVNPFALYLLSKSFRKQFNTQLLCCQPGLIIRSHSTGRSTTCMTSLKSTNPSVATFSLINGNICHERYV

Reference




    Data / case study


    Click to get more Data / Case study about the product.



    Associated products


    Category Cat No. Products Name
    Target Antibody GM-Tg-g-T99816-Ab Anti-GRPR/ BB2/ BB2R monoclonal antibody
    Target Antigen GM-Tg-g-T99816-Ag GRPR VLP (virus-like particle)
    ORF Viral Vector pGMLP003622 Human GRPR Lentivirus plasmid
    ORF Viral Vector pGMPC000580 Human GRPR Mammalian (Non-Viral Vector) plasmid
    ORF Viral Vector pGMPC000624 Human GRPR Mammalian (Non-Viral Vector) plasmid
    ORF Viral Vector vGMLP003622 Human GRPR Lentivirus particle


    Target information

    Target ID GM-T99816
    Target Name GRPR
    Gene ID 2925, 14829, 574339, 24938, 101096951, 491754, 532784, 100056400
    Gene Symbol and Synonyms BB2,BB2R,BRS2,GRP-R,GRPR
    Uniprot Accession P30550
    Uniprot Entry Name GRPR_HUMAN
    Protein Sub-location Transmembrane Protein
    Category Therapeutics Target
    Disease Not Available
    Gene Ensembl ENSG00000126010
    Target Classification GPCR

    Gastrin-releasing peptide (GRP) regulates numerous functions of the gastrointestinal and central nervous systems, including release of gastrointestinal hormones, smooth muscle cell contraction, and epithelial cell proliferation and is a potent mitogen for neoplastic tissues. The effects of GRP are mediated through the gastrin-releasing peptide receptor. This receptor is a glycosylated, 7-transmembrane G-protein coupled receptor that activates the phospholipase C signaling pathway. The receptor is aberrantly expressed in numerous cancers such as those of the lung, colon, and prostate. An individual with autism and multiple exostoses was found to have a balanced translocation between chromosome 8 and a chromosome X breakpoint located within the gastrin-releasing peptide receptor gene. [provided by RefSeq, Jul 2008]



    About GMVC

    GDU

    GMVC (GM Vector Core) is GeneMedi’s unique platform for QbD Viral vectors Processes development and manufacturing. In GMVC, our core expertise lies in the tailored production of viral vectors, including adeno-associated virus (AAV), lentivirus, and adenovirus. Our state-of-the-art facilities are equipped for scalable manufacturing, ensuring high-quality viral vector production to meet both research and therapeutic needs. Our expert team specializes in process development, leveraging innovative technology and extensive industry knowledge to provide clients with tailored solutions that exceed expectations. GMVC will be the ideal partner for scientists and healthcare professionals seeking reliable and efficient viral vector production services.