Human OAS1/E18/E16/ IFI-4 ORF/cDNA clone-Lentivirus plasmid (NM_016816)

Pre-made Human OAS1/E18/E16/ IFI-4 Lentiviral expression plasmid for OAS1 lentivirus packaging, OAS1 lentivirus production, overexpression stable cell line development, cell transient transfection and gene delivery targeting T/B/NK cells, macrophages, cardiomyocytes, hepatocytes, and neurons.

Our GM-Lentiviral vector is seamlessly integrated with the GM lentivirus packaging system. Discover more about the GM lentivirus packaging system.

Target products collectionGo to OAS1/E18/E16 products collection >>
(antibodies, antigen, VLP, mRNA, ORF viral vector, etc)



Product information

Catalog No. Product Name Plasmid Grade Plasmid quantity
pGMLP003646 Human OAS1 Lentivirus plasmid Research Grade 10mg, 50mg, 100mg, 500mg, >1g
GMP-like Grade 10mg, 50mg, 100mg, 500mg, >1g
High Quality (HQ) Grade
Seed 5ug


Product Description

Catalog ID pGMLP003646
Gene Name OAS1
Accession Number NM_016816
Gene ID 4938
Species Human
Product Type Lentivirus plasmid (overexpression)
Insert Length 1203 bp
Gene Alias E18/E16, IFI-4, OIAS, OIASI
Fluorescent Reporter ZsGreen
Mammalian Cell Selection Puromyocin
Fusion Tag 3xflag (C-Terminal)
Promoter CMV
Resistance Amplicin
Sequence ATGATGGATCTCAGAAATACCCCAGCCAAATCTCTGGACAAGTTCATTGAAGACTATCTCTTGCCAGACACGTGTTTCCGCATGCAAATCAACCATGCCATTGACATCATCTGTGGGTTCCTGAAGGAAAGGTGCTTCCGAGGTAGCTCCTACCCTGTGTGTGTGTCCAAGGTGGTAAAGGGTGGCTCCTCAGGCAAGGGCACCACCCTCAGAGGCCGATCTGACGCTGACCTGGTTGTCTTCCTCAGTCCTCTCACCACTTTTCAGGATCAGTTAAATCGCCGGGGAGAGTTCATCCAGGAAATTAGGAGACAGCTGGAAGCCTGTCAAAGAGAGAGAGCATTTTCCGTGAAGTTTGAGGTCCAGGCTCCACGCTGGGGCAACCCCCGTGCGCTCAGCTTCGTACTGAGTTCGCTCCAGCTCGGGGAGGGGGTGGAGTTCGATGTGCTGCCTGCCTTTGATGCCCTGGGTCAGTTGACTGGCGGCTATAAACCTAACCCCCAAATCTATGTCAAGCTCATCGAGGAGTGCACCGACCTGCAGAAAGAGGGCGAGTTCTCCACCTGCTTCACAGAACTACAGAGAGACTTCCTGAAGCAGCGCCCCACCAAGCTCAAGAGCCTCATCCGCCTAGTCAAGCACTGGTACCAAAATTGTAAGAAGAAGCTTGGGAAGCTGCCACCTCAGTATGCCCTGGAGCTCCTGACGGTCTATGCTTGGGAGCGAGGGAGCATGAAAACACATTTCAACACAGCCCAGGGATTTCGGACGGTCTTGGAATTAGTCATAAACTACCAGCAACTCTGCATCTACTGGACAAAGTATTATGACTTTAAAAACCCCATTATTGAAAAGTACCTGAGAAGGCAGCTCACGAAACCCAGGCCTGTGATCCTGGACCCGGCGGACCCTACAGGAAACTTGGGTGGTGGAGACCCAAAGGGTTGGAGGCAGCTGGCACAAGAGGCTGAGGCCTGGCTGAATTACCCATGCTTTAAGAATTGGGATGGGTCCCCAGTGAGCTCCTGGATTCTGCTGGCTGAAAGCAACAGTGCAGACGATGAGACCGACGATCCCAGGAGGTATCAGAAATATGGTTACATTGGAACACATGAGTACCCTCATTTCTCTCATAGACCCAGCACACTCCAGGCAGCATCCACCCCACAGGCAGAAGAGGACTGGACCTGCACCATCCTCTGA

Reference




    Data / case study


    Click to get more Data / Case study about the product.



    Associated products


    Category Cat No. Products Name
    Target Antibody GM-Tg-g-SE1429-Ab Anti-OAS1/ E18/E16/ IFI-4 functional antibody
    Target Antigen GM-Tg-g-SE1429-Ag OAS1 protein
    ORF Viral Vector pGMPC001022 Human OAS1 Mammalian (Non-Viral Vector) plasmid
    ORF Viral Vector pGMLP003646 Human OAS1 Lentivirus plasmid
    ORF Viral Vector vGMLP003646 Human OAS1 Lentivirus particle


    Target information

    Target ID GM-SE1429
    Target Name OAS1
    Gene ID 4938, 712265, 101087875, 608778, 100034147
    Gene Symbol and Synonyms E18/E16,IFI-4,IMD100,OAS1,OIAS,OIASI
    Uniprot Accession P00973
    Uniprot Entry Name OAS1_HUMAN
    Protein Sub-location Secreted Protein/Potential Cytokines
    Category Not Available
    Disease Prostate Cancer
    Gene Ensembl ENSG00000089127
    Target Classification Not Available

    This interferon-induced gene encodes a protein that synthesizes 2',5'-oligoadenylates (2-5As). This protein plays a key role in innate cellular antiviral response, and has been implicated in other cellular processes like cell growth and apoptosis. Alternative splicing results in multiple transcript variants with different enzymatic activities. Polymorphisms in this gene have been associated with susceptibility to viral infection, including SARS-CoV-2, and diabetes mellitus, type 1. This gene is located in a cluster of related genes on chromosome 12. [provided by RefSeq, May 2022]



    About GMVC

    GDU



    GMVC (GM Vector Core) is GeneMedi’s unique platform for QbD Viral vectors Processes development and manufacturing. In GMVC, our core expertise lies in the tailored production of viral vectors, including adeno-associated virus (AAV), lentivirus, and adenovirus. Our state-of-the-art facilities are equipped for scalable manufacturing, ensuring high-quality viral vector production to meet both research and therapeutic needs. Our expert team specializes in process development, leveraging innovative technology and extensive industry knowledge to provide clients with tailored solutions that exceed expectations. GMVC will be the ideal partner for scientists and healthcare professionals seeking reliable and efficient viral vector production services.