Human OAS1/E18/E16/ IFI-4 ORF/cDNA clone-Lentivirus plasmid (NM_016816)
Pre-made Human OAS1/E18/E16/ IFI-4 Lentiviral expression plasmid for OAS1 lentivirus packaging, OAS1 lentivirus production, overexpression stable cell line development, cell transient transfection and gene delivery targeting T/B/NK cells, macrophages, cardiomyocytes, hepatocytes, and neurons.
Our GM-Lentiviral vector is seamlessly integrated with the GM lentivirus packaging system. Discover more about the GM lentivirus packaging system.
Go
to OAS1/E18/E16 products collection
>>
(antibodies,
antigen, VLP, mRNA, ORF viral vector, etc)
Product information
Catalog No. | Product Name | Plasmid Grade | Plasmid quantity |
---|---|---|---|
pGMLP003646 | Human OAS1 Lentivirus plasmid | Research Grade | 10mg, 50mg, 100mg, 500mg, >1g |
GMP-like Grade | 10mg, 50mg, 100mg, 500mg, >1g | ||
High Quality (HQ) Grade | |||
Seed | 5ug |
Product Description
Catalog ID | pGMLP003646 |
Gene Name | OAS1 |
Accession Number | NM_016816 |
Gene ID | 4938 |
Species | Human |
Product Type | Lentivirus plasmid (overexpression) |
Insert Length | 1203 bp |
Gene Alias | E18/E16, IFI-4, OIAS, OIASI |
Fluorescent Reporter | ZsGreen |
Mammalian Cell Selection | Puromyocin |
Fusion Tag | 3xflag (C-Terminal) |
Promoter | CMV |
Resistance | Amplicin |
Sequence | ATGATGGATCTCAGAAATACCCCAGCCAAATCTCTGGACAAGTTCATTGAAGACTATCTCTTGCCAGACACGTGTTTCCGCATGCAAATCAACCATGCCATTGACATCATCTGTGGGTTCCTGAAGGAAAGGTGCTTCCGAGGTAGCTCCTACCCTGTGTGTGTGTCCAAGGTGGTAAAGGGTGGCTCCTCAGGCAAGGGCACCACCCTCAGAGGCCGATCTGACGCTGACCTGGTTGTCTTCCTCAGTCCTCTCACCACTTTTCAGGATCAGTTAAATCGCCGGGGAGAGTTCATCCAGGAAATTAGGAGACAGCTGGAAGCCTGTCAAAGAGAGAGAGCATTTTCCGTGAAGTTTGAGGTCCAGGCTCCACGCTGGGGCAACCCCCGTGCGCTCAGCTTCGTACTGAGTTCGCTCCAGCTCGGGGAGGGGGTGGAGTTCGATGTGCTGCCTGCCTTTGATGCCCTGGGTCAGTTGACTGGCGGCTATAAACCTAACCCCCAAATCTATGTCAAGCTCATCGAGGAGTGCACCGACCTGCAGAAAGAGGGCGAGTTCTCCACCTGCTTCACAGAACTACAGAGAGACTTCCTGAAGCAGCGCCCCACCAAGCTCAAGAGCCTCATCCGCCTAGTCAAGCACTGGTACCAAAATTGTAAGAAGAAGCTTGGGAAGCTGCCACCTCAGTATGCCCTGGAGCTCCTGACGGTCTATGCTTGGGAGCGAGGGAGCATGAAAACACATTTCAACACAGCCCAGGGATTTCGGACGGTCTTGGAATTAGTCATAAACTACCAGCAACTCTGCATCTACTGGACAAAGTATTATGACTTTAAAAACCCCATTATTGAAAAGTACCTGAGAAGGCAGCTCACGAAACCCAGGCCTGTGATCCTGGACCCGGCGGACCCTACAGGAAACTTGGGTGGTGGAGACCCAAAGGGTTGGAGGCAGCTGGCACAAGAGGCTGAGGCCTGGCTGAATTACCCATGCTTTAAGAATTGGGATGGGTCCCCAGTGAGCTCCTGGATTCTGCTGGCTGAAAGCAACAGTGCAGACGATGAGACCGACGATCCCAGGAGGTATCAGAAATATGGTTACATTGGAACACATGAGTACCCTCATTTCTCTCATAGACCCAGCACACTCCAGGCAGCATCCACCCCACAGGCAGAAGAGGACTGGACCTGCACCATCCTCTGA |
Reference
Data / case study
Click to get more Data / Case study about the product.
Associated products
Category | Cat No. | Products Name |
---|---|---|
Target Antibody | GM-Tg-g-SE1429-Ab | Anti-OAS1/ E18/E16/ IFI-4 functional antibody |
Target Antigen | GM-Tg-g-SE1429-Ag | OAS1 protein |
ORF Viral Vector | pGMPC001022 | Human OAS1 Mammalian (Non-Viral Vector) plasmid |
ORF Viral Vector | pGMLP003646 | Human OAS1 Lentivirus plasmid |
ORF Viral Vector | vGMLP003646 | Human OAS1 Lentivirus particle |
Target information
Target ID | GM-SE1429 |
Target Name | OAS1 |
Gene ID | 4938, 712265, 101087875, 608778, 100034147 |
Gene Symbol and Synonyms | E18/E16,IFI-4,IMD100,OAS1,OIAS,OIASI |
Uniprot Accession | P00973 |
Uniprot Entry Name | OAS1_HUMAN |
Protein Sub-location | Secreted Protein/Potential Cytokines |
Category | Not Available |
Disease | Prostate Cancer |
Gene Ensembl | ENSG00000089127 |
Target Classification | Not Available |
This interferon-induced gene encodes a protein that synthesizes 2',5'-oligoadenylates (2-5As). This protein plays a key role in innate cellular antiviral response, and has been implicated in other cellular processes like cell growth and apoptosis. Alternative splicing results in multiple transcript variants with different enzymatic activities. Polymorphisms in this gene have been associated with susceptibility to viral infection, including SARS-CoV-2, and diabetes mellitus, type 1. This gene is located in a cluster of related genes on chromosome 12. [provided by RefSeq, May 2022]
About GMVC
GMVC (GM Vector Core) is GeneMedi’s unique platform for QbD Viral vectors Processes development and manufacturing. In GMVC, our core expertise lies in the tailored production of viral vectors, including adeno-associated virus (AAV), lentivirus, and adenovirus. Our state-of-the-art facilities are equipped for scalable manufacturing, ensuring high-quality viral vector production to meet both research and therapeutic needs. Our expert team specializes in process development, leveraging innovative technology and extensive industry knowledge to provide clients with tailored solutions that exceed expectations. GMVC will be the ideal partner for scientists and healthcare professionals seeking reliable and efficient viral vector production services.