Human SHBG/ABP/ SBP ORF/cDNA clone-Lentivirus plasmid (NM_001040)

Pre-made Human SHBG/ABP/ SBP Lentiviral expression plasmid for SHBG lentivirus packaging, SHBG lentivirus production, overexpression stable cell line development, cell transient transfection and gene delivery targeting T/B/NK cells, macrophages, cardiomyocytes, hepatocytes, and neurons.

Our GM-Lentiviral vector is seamlessly integrated with the GM lentivirus packaging system. Discover more about the GM lentivirus packaging system.

Target products collectionGo to SHBG/ABP products collection >>
(antibodies, antigen, VLP, mRNA, ORF viral vector, etc)



Product information

Catalog No. Product Name Plasmid Grade Plasmid quantity
pGMLP003648 Human SHBG Lentivirus plasmid Research Grade 10mg, 50mg, 100mg, 500mg, >1g
GMP-like Grade 10mg, 50mg, 100mg, 500mg, >1g
High Quality (HQ) Grade
Seed 5ug


Product Description

Catalog ID pGMLP003648
Gene Name SHBG
Accession Number NM_001040
Gene ID 6462
Species Human
Product Type Lentivirus plasmid (overexpression)
Insert Length 1209 bp
Gene Alias ABP, SBP, TEBG
Fluorescent Reporter ZsGreen
Mammalian Cell Selection Puromyocin
Fusion Tag 3xflag (C-Terminal)
Promoter CMV
Resistance Amplicin
Sequence ATGGAGAGCAGAGGCCCACTGGCTACCTCGCGCCTGCTGCTGTTGCTGCTGTTGCTACTACTGCGTCACACCCGCCAGGGATGGGCCCTGAGACCTGTTCTCCCCACCCAGAGTGCCCACGACCCTCCGGCTGTCCACCTCAGCAATGGCCCAGGACAAGAGCCTATCGCTGTCATGACCTTTGACCTCACCAAGATCACAAAAACCTCCTCCTCCTTTGAGGTTCGAACCTGGGACCCAGAGGGAGTGATTTTTTATGGGGATACCAACCCTAAGGATGACTGGTTTATGCTGGGACTTCGAGACGGCAGGCCTGAGATCCAACTGCACAATCACTGGGCCCAGCTTACGGTGGGTGCTGGACCACGGCTGGATGATGGGAGATGGCACCAGGTGGAAGTCAAGATGGAGGGGGACTCTGTGCTGCTGGAGGTGGATGGGGAGGAGGTGCTGCGCCTGAGACAGGTCTCTGGGCCCCTGACCAGCAAACGCCATCCCATCATGAGGATTGCGCTTGGGGGGCTGCTCTTCCCCGCTTCCAACCTTCGGTTGCCGCTGGTTCCTGCCCTGGATGGCTGCCTGCGCCGGGATTCCTGGCTGGACAAACAGGCCGAGATCTCAGCATCTGCCCCCACTAGCCTCAGAAGCTGTGATGTAGAATCAAATCCCGGGATATTTCTCCCTCCAGGGACTCAGGCAGAATTCAATCTCCGAGACATTCCCCAGCCTCATGCAGAGCCCTGGGCCTTCTCTTTGGACCTGGGACTCAAGCAGGCAGCAGGCTCAGGCCACCTCCTTGCTCTTGGGACACCAGAGAACCCATCTTGGCTCAGTCTCCACCTCCAAGATCAAAAGGTGGTGTTGTCTTCTGGGTCGGGGCCAGGGCTGGATCTGCCCCTGGTCTTGGGACTCCCTCTTCAGCTGAAGCTGAGTATGTCCAGGGTGGTCTTGAGCCAAGGGTCGAAGATGAAGGCCCTTGCCCTGCCTCCCTTAGGCCTGGCTCCCCTCCTTAACCTCTGGGCCAAGCCTCAAGGGCGTCTCTTCCTGGGGGCTTTACCAGGAGAAGACTCTTCCACCTCTTTTTGCCTGAATGGCCTTTGGGCACAAGGTCAGAGGCTGGATGTGGACCAGGCCCTGAACAGAAGCCATGAGATCTGGACTCACAGCTGCCCCCAGAGCCCAGGCAATGGCACTGACGCTTCCCATTAA

Reference




    Data / case study


    Click to get more Data / Case study about the product.



    Associated products


    Category Cat No. Products Name
    Target Antibody GM-Tg-g-SE1290-Ab Anti-SHBG/ ABP/ SBP functional antibody
    Target Antigen GM-Tg-g-SE1290-Ag SHBG protein
    ORF Viral Vector pGMLP003648 Human SHBG Lentivirus plasmid
    ORF Viral Vector vGMLP003648 Human SHBG Lentivirus particle


    Target information

    Target ID GM-SE1290
    Target Name SHBG
    Gene ID 6462, 20415, 716004, 24775, 101099508, 100856157, 404182, 100073011
    Gene Symbol and Synonyms ABP,Abpa,SBP,SHBG,TEBG
    Uniprot Accession P04278
    Uniprot Entry Name SHBG_HUMAN
    Protein Sub-location Secreted Protein/Potential Cytokines
    Category Not Available
    Disease Other diseases of intestines (K55-K64)
    Gene Ensembl ENSG00000129214
    Target Classification Not Available

    This gene encodes a steroid binding protein that was first described as a plasma protein secreted by the liver but is now thought to participate in the regulation of steroid responses. The encoded protein transports androgens and estrogens in the blood, binding each steroid molecule as a dimer formed from identical or nearly identical monomers. Polymorphisms in this gene have been associated with polycystic ovary syndrome and type 2 diabetes mellitus. Alternative splicing results in multiple transcript variants. [provided by RefSeq, Jan 2014]



    About GMVC

    GDU



    GMVC (GM Vector Core) is GeneMedi’s unique platform for QbD Viral vectors Processes development and manufacturing. In GMVC, our core expertise lies in the tailored production of viral vectors, including adeno-associated virus (AAV), lentivirus, and adenovirus. Our state-of-the-art facilities are equipped for scalable manufacturing, ensuring high-quality viral vector production to meet both research and therapeutic needs. Our expert team specializes in process development, leveraging innovative technology and extensive industry knowledge to provide clients with tailored solutions that exceed expectations. GMVC will be the ideal partner for scientists and healthcare professionals seeking reliable and efficient viral vector production services.