Human SHBG/ABP/ SBP ORF/cDNA clone-Lentivirus plasmid (NM_001040)
Pre-made Human SHBG/ABP/ SBP Lentiviral expression plasmid for SHBG lentivirus packaging, SHBG lentivirus production, overexpression stable cell line development, cell transient transfection and gene delivery targeting T/B/NK cells, macrophages, cardiomyocytes, hepatocytes, and neurons.
Our GM-Lentiviral vector is seamlessly integrated with the GM lentivirus packaging system. Discover more about the GM lentivirus packaging system.
Go
to SHBG/ABP products collection
>>
(antibodies,
antigen, VLP, mRNA, ORF viral vector, etc)
Product information
Catalog No. | Product Name | Plasmid Grade | Plasmid quantity |
---|---|---|---|
pGMLP003648 | Human SHBG Lentivirus plasmid | Research Grade | 10mg, 50mg, 100mg, 500mg, >1g |
GMP-like Grade | 10mg, 50mg, 100mg, 500mg, >1g | ||
High Quality (HQ) Grade | |||
Seed | 5ug |
Product Description
Catalog ID | pGMLP003648 |
Gene Name | SHBG |
Accession Number | NM_001040 |
Gene ID | 6462 |
Species | Human |
Product Type | Lentivirus plasmid (overexpression) |
Insert Length | 1209 bp |
Gene Alias | ABP, SBP, TEBG |
Fluorescent Reporter | ZsGreen |
Mammalian Cell Selection | Puromyocin |
Fusion Tag | 3xflag (C-Terminal) |
Promoter | CMV |
Resistance | Amplicin |
Sequence | ATGGAGAGCAGAGGCCCACTGGCTACCTCGCGCCTGCTGCTGTTGCTGCTGTTGCTACTACTGCGTCACACCCGCCAGGGATGGGCCCTGAGACCTGTTCTCCCCACCCAGAGTGCCCACGACCCTCCGGCTGTCCACCTCAGCAATGGCCCAGGACAAGAGCCTATCGCTGTCATGACCTTTGACCTCACCAAGATCACAAAAACCTCCTCCTCCTTTGAGGTTCGAACCTGGGACCCAGAGGGAGTGATTTTTTATGGGGATACCAACCCTAAGGATGACTGGTTTATGCTGGGACTTCGAGACGGCAGGCCTGAGATCCAACTGCACAATCACTGGGCCCAGCTTACGGTGGGTGCTGGACCACGGCTGGATGATGGGAGATGGCACCAGGTGGAAGTCAAGATGGAGGGGGACTCTGTGCTGCTGGAGGTGGATGGGGAGGAGGTGCTGCGCCTGAGACAGGTCTCTGGGCCCCTGACCAGCAAACGCCATCCCATCATGAGGATTGCGCTTGGGGGGCTGCTCTTCCCCGCTTCCAACCTTCGGTTGCCGCTGGTTCCTGCCCTGGATGGCTGCCTGCGCCGGGATTCCTGGCTGGACAAACAGGCCGAGATCTCAGCATCTGCCCCCACTAGCCTCAGAAGCTGTGATGTAGAATCAAATCCCGGGATATTTCTCCCTCCAGGGACTCAGGCAGAATTCAATCTCCGAGACATTCCCCAGCCTCATGCAGAGCCCTGGGCCTTCTCTTTGGACCTGGGACTCAAGCAGGCAGCAGGCTCAGGCCACCTCCTTGCTCTTGGGACACCAGAGAACCCATCTTGGCTCAGTCTCCACCTCCAAGATCAAAAGGTGGTGTTGTCTTCTGGGTCGGGGCCAGGGCTGGATCTGCCCCTGGTCTTGGGACTCCCTCTTCAGCTGAAGCTGAGTATGTCCAGGGTGGTCTTGAGCCAAGGGTCGAAGATGAAGGCCCTTGCCCTGCCTCCCTTAGGCCTGGCTCCCCTCCTTAACCTCTGGGCCAAGCCTCAAGGGCGTCTCTTCCTGGGGGCTTTACCAGGAGAAGACTCTTCCACCTCTTTTTGCCTGAATGGCCTTTGGGCACAAGGTCAGAGGCTGGATGTGGACCAGGCCCTGAACAGAAGCCATGAGATCTGGACTCACAGCTGCCCCCAGAGCCCAGGCAATGGCACTGACGCTTCCCATTAA |
Reference
Data / case study
Click to get more Data / Case study about the product.
Associated products
Category | Cat No. | Products Name |
---|---|---|
Target Antibody | GM-Tg-g-SE1290-Ab | Anti-SHBG/ ABP/ SBP functional antibody |
Target Antigen | GM-Tg-g-SE1290-Ag | SHBG protein |
ORF Viral Vector | pGMLP003648 | Human SHBG Lentivirus plasmid |
ORF Viral Vector | vGMLP003648 | Human SHBG Lentivirus particle |
Target information
Target ID | GM-SE1290 |
Target Name | SHBG |
Gene ID | 6462, 20415, 716004, 24775, 101099508, 100856157, 404182, 100073011 |
Gene Symbol and Synonyms | ABP,Abpa,SBP,SHBG,TEBG |
Uniprot Accession | P04278 |
Uniprot Entry Name | SHBG_HUMAN |
Protein Sub-location | Secreted Protein/Potential Cytokines |
Category | Not Available |
Disease | Other diseases of intestines (K55-K64) |
Gene Ensembl | ENSG00000129214 |
Target Classification | Not Available |
This gene encodes a steroid binding protein that was first described as a plasma protein secreted by the liver but is now thought to participate in the regulation of steroid responses. The encoded protein transports androgens and estrogens in the blood, binding each steroid molecule as a dimer formed from identical or nearly identical monomers. Polymorphisms in this gene have been associated with polycystic ovary syndrome and type 2 diabetes mellitus. Alternative splicing results in multiple transcript variants. [provided by RefSeq, Jan 2014]
About GMVC
GMVC (GM Vector Core) is GeneMedi’s unique platform for QbD Viral vectors Processes development and manufacturing. In GMVC, our core expertise lies in the tailored production of viral vectors, including adeno-associated virus (AAV), lentivirus, and adenovirus. Our state-of-the-art facilities are equipped for scalable manufacturing, ensuring high-quality viral vector production to meet both research and therapeutic needs. Our expert team specializes in process development, leveraging innovative technology and extensive industry knowledge to provide clients with tailored solutions that exceed expectations. GMVC will be the ideal partner for scientists and healthcare professionals seeking reliable and efficient viral vector production services.