Human EGLN2/EIT6/HIF-PH1 ORF/cDNA clone-Lentivirus plasmid (NM_080732)

Cat. No.: pGMLP003654
Size: 10 µg
Concentration: generally 0.5ug/ul, usually not less than 0.3ug/ul
Leading Time: 3-7 working days

Pre-made Human EGLN2/EIT6/HIF-PH1 Lentiviral expression plasmid for EGLN2 lentivirus packaging, EGLN2 lentivirus production, overexpression stable cell line development, cell transient transfection and gene delivery targeting T/B/NK cells, macrophages, cardiomyocytes, hepatocytes, and neurons.

Our GM-Lentiviral vector is seamlessly integrated with the GM lentivirus packaging system. Discover more about the GM lentivirus packaging system.

pdf Datasheet
pdf MSDS
pdf Terms of Use
Target products collection

Go to HPH-1/EGLN2/EIT6 products collection>>
(antibodies, antigen, VLP, mRNA, ORF viral vector, etc)

Purchase
Total Price: $642.72
Shipping fee: Limited-time free
For payment issues, contact us.


Product Description

Catalog ID pGMLP003654
Gene Name EGLN2
Accession Number NM_080732
Gene ID 112398
Species Human
Product Type Lentivirus plasmid (overexpression)
Insert Length 1224 bp
Gene Alias EIT6,HIF-PH1,HIFPH1,HPH-1,HPH-3,PHD1
Fluorescent Reporter ZsGreen
Mammalian Cell Selection Puromyocin
Fusion Tag 3xflag (C-Terminal)
Promoter CMV
Resistance Amplicin
ORF Nucleotide Sequence ATGGACAGCCCGTGCCAGCCGCAGCCCCTAAGTCAGGCTCTCCCTCAGTTACCAGGGTCTTCGTCAGAGCCCTTGGAGCCTGAGCCTGGCCGGGCCAGGATGGGAGTGGAGAGTTACCTGCCCTGTCCCCTGCTCCCCTCCTACCACTGTCCAGGAGTGCCTAGTGAGGCCTCGGCAGGGAGTGGGACCCCCAGAGCCACAGCCACCTCTACCACTGCCAGCCCTCTTCGGGACGGTTTTGGCGGGCAGGATGGTGGTGAGCTGCGGCCGCTGCAGAGTGAAGGCGCTGCAGCGCTGGTCACCAAGGGGTGCCAGCGATTGGCAGCCCAGGGCGCACGGCCTGAGGCCCCCAAACGGAAATGGGCCGAGGATGGTGGGGATGCCCCTTCACCCAGCAAACGGCCCTGGGCCAGGCAAGAGAACCAGGAGGCAGAGCGGGAGGGTGGCATGAGCTGCAGCTGCAGCAGTGGCAGTGGTGAGGCCAGTGCTGGGCTGATGGAGGAGGCGCTGCCCTCTGCGCCCGAGCGCCTGGCCCTGGACTATATCGTGCCCTGCATGCGGTACTACGGCATCTGCGTCAAGGACAGCTTCCTGGGGGCAGCACTGGGCGGTCGCGTGCTGGCCGAGGTGGAGGCCCTCAAACGGGGTGGGCGCCTGCGAGACGGGCAGCTAGTGAGCCAGAGGGCGATCCCGCCGCGCAGCATCCGTGGGGACCAGATTGCCTGGGTGGAAGGCCATGAACCAGGCTGTCGAAGCATTGGTGCCCTCATGGCCCATGTGGACGCCGTCATCCGCCACTGCGCAGGGCGGCTGGGCAGCTATGTCATCAACGGGCGCACCAAGGCCATGGTGGCGTGTTACCCAGGCAACGGGCTCGGGTACGTAAGGCACGTTGACAATCCCCACGGCGATGGGCGCTGCATCACCTGTATCTATTACCTGAATCAGAACTGGGACGTTAAGGTGCATGGCGGCCTGCTGCAGATCTTCCCTGAGGGCCGGCCCGTGGTAGCCAACATCGAGCCACTCTTTGACCGGTTGCTCATTTTCTGGTCTGACCGGCGGAACCCCCACGAGGTGAAGCCAGCCTATGCCACCAGGTACGCCATCACTGTCTGGTATTTTGATGCCAAGGAGCGGGCAGCAGCCAAAGACAAGTATCAGCTAGCATCAGGACAGAAAGGTGTCCAAGTACCTGTATCACAGCCGCCTACGCCCACCTAG
ORF Protein Sequence MDSPCQPQPLSQALPQLPGSSSEPLEPEPGRARMGVESYLPCPLLPSYHCPGVPSEASAGSGTPRATATSTTASPLRDGFGGQDGGELRPLQSEGAAALVTKGCQRLAAQGARPEAPKRKWAEDGGDAPSPSKRPWARQENQEAEREGGMSCSCSSGSGEASAGLMEEALPSAPERLALDYIVPCMRYYGICVKDSFLGAALGGRVLAEVEALKRGGRLRDGQLVSQRAIPPRSIRGDQIAWVEGHEPGCRSIGALMAHVDAVIRHCAGRLGSYVINGRTKAMVACYPGNGLGYVRHVDNPHGDGRCITCIYYLNQNWDVKVHGGLLQIFPEGRPVVANIEPLFDRLLIFWSDRRNPHEVKPAYATRYAITVWYFDAKERAAAKDKYQLASGQKGVQVPVSQPPTPT

Reference




    Data / case study


    Click to get more Data / Case study about the product.



    Associated products


    Category Cat No. Products Name
    Target Antibody GM-Tg-g-T53904-Ab Anti-HPH-1 monoclonal antibody
    Target Antigen GM-Tg-g-T53904-Ag HPH-1/EGLN2 protein
    ORF Viral Vector pGMLP003654 Human EGLN2 Lentivirus plasmid
    ORF Viral Vector vGMLP003654 Human EGLN2 Lentivirus particle


    Target information

    Target ID GM-T53904
    Target Name HPH-1
    Gene ID 112398, 112406, 114674212, 308457, 101090063, 484495, 536763, 100064859
    Gene Symbol and Synonyms 0610011A13Rik,EGLN2,EIT-6,EIT6,Hif-p4h-1,HIF-PH1,HIFPH1,HPH-1,HPH-3,Ier4,PHD-1,PHD1,SM-20
    Uniprot Accession Q96KS0
    Uniprot Entry Name EGLN2_HUMAN
    Protein Sub-location Introcelluar Protein
    Category Therapeutics Target
    Disease Not Available
    Gene Ensembl ENSG00000269858
    Target Classification Not Available

    The hypoxia inducible factor (HIF) is a transcriptional complex that is involved in oxygen homeostasis. At normal oxygen levels, the alpha subunit of HIF is targeted for degration by prolyl hydroxylation. This gene encodes an enzyme responsible for this post-translational modification. Alternative splicing results in multiple transcript variants. Read-through transcription also exists between this gene and the upstream RAB4B (RAB4B, member RAS oncogene family) gene. [provided by RefSeq, Feb 2011]



    About GMVC

    GDU

    GMVC (GM Vector Core) is GeneMedi’s unique platform for QbD Viral vectors Processes development and manufacturing. In GMVC, our core expertise lies in the tailored production of viral vectors, including adeno-associated virus (AAV), lentivirus, and adenovirus. Our state-of-the-art facilities are equipped for scalable manufacturing, ensuring high-quality viral vector production to meet both research and therapeutic needs. Our expert team specializes in process development, leveraging innovative technology and extensive industry knowledge to provide clients with tailored solutions that exceed expectations. GMVC will be the ideal partner for scientists and healthcare professionals seeking reliable and efficient viral vector production services.