Human EGLN2/EIT6/HIF-PH1 ORF/cDNA clone-Lentivirus plasmid (NM_080732)
Cat. No.: pGMLP003654
Size: 10 µg
Concentration: generally 0.5ug/ul, usually not less than 0.3ug/ul
Leading Time: 3-7 working days
Pre-made Human EGLN2/EIT6/HIF-PH1 Lentiviral expression plasmid for EGLN2 lentivirus packaging, EGLN2 lentivirus production, overexpression stable cell line development, cell transient transfection and gene delivery targeting T/B/NK cells, macrophages, cardiomyocytes, hepatocytes, and neurons.
Our GM-Lentiviral vector is seamlessly integrated with the GM lentivirus packaging system. Discover more about the GM lentivirus packaging system.
Go to
HPH-1/EGLN2/EIT6 products
collection>>
(antibodies,
antigen, VLP, mRNA, ORF viral vector, etc)
Product Description
Catalog ID | pGMLP003654 |
Gene Name | EGLN2 |
Accession Number | NM_080732 |
Gene ID | 112398 |
Species | Human |
Product Type | Lentivirus plasmid (overexpression) |
Insert Length | 1224 bp |
Gene Alias | EIT6,HIF-PH1,HIFPH1,HPH-1,HPH-3,PHD1 |
Fluorescent Reporter | ZsGreen |
Mammalian Cell Selection | Puromyocin |
Fusion Tag | 3xflag (C-Terminal) |
Promoter | CMV |
Resistance | Amplicin |
ORF Nucleotide Sequence | ATGGACAGCCCGTGCCAGCCGCAGCCCCTAAGTCAGGCTCTCCCTCAGTTACCAGGGTCTTCGTCAGAGCCCTTGGAGCCTGAGCCTGGCCGGGCCAGGATGGGAGTGGAGAGTTACCTGCCCTGTCCCCTGCTCCCCTCCTACCACTGTCCAGGAGTGCCTAGTGAGGCCTCGGCAGGGAGTGGGACCCCCAGAGCCACAGCCACCTCTACCACTGCCAGCCCTCTTCGGGACGGTTTTGGCGGGCAGGATGGTGGTGAGCTGCGGCCGCTGCAGAGTGAAGGCGCTGCAGCGCTGGTCACCAAGGGGTGCCAGCGATTGGCAGCCCAGGGCGCACGGCCTGAGGCCCCCAAACGGAAATGGGCCGAGGATGGTGGGGATGCCCCTTCACCCAGCAAACGGCCCTGGGCCAGGCAAGAGAACCAGGAGGCAGAGCGGGAGGGTGGCATGAGCTGCAGCTGCAGCAGTGGCAGTGGTGAGGCCAGTGCTGGGCTGATGGAGGAGGCGCTGCCCTCTGCGCCCGAGCGCCTGGCCCTGGACTATATCGTGCCCTGCATGCGGTACTACGGCATCTGCGTCAAGGACAGCTTCCTGGGGGCAGCACTGGGCGGTCGCGTGCTGGCCGAGGTGGAGGCCCTCAAACGGGGTGGGCGCCTGCGAGACGGGCAGCTAGTGAGCCAGAGGGCGATCCCGCCGCGCAGCATCCGTGGGGACCAGATTGCCTGGGTGGAAGGCCATGAACCAGGCTGTCGAAGCATTGGTGCCCTCATGGCCCATGTGGACGCCGTCATCCGCCACTGCGCAGGGCGGCTGGGCAGCTATGTCATCAACGGGCGCACCAAGGCCATGGTGGCGTGTTACCCAGGCAACGGGCTCGGGTACGTAAGGCACGTTGACAATCCCCACGGCGATGGGCGCTGCATCACCTGTATCTATTACCTGAATCAGAACTGGGACGTTAAGGTGCATGGCGGCCTGCTGCAGATCTTCCCTGAGGGCCGGCCCGTGGTAGCCAACATCGAGCCACTCTTTGACCGGTTGCTCATTTTCTGGTCTGACCGGCGGAACCCCCACGAGGTGAAGCCAGCCTATGCCACCAGGTACGCCATCACTGTCTGGTATTTTGATGCCAAGGAGCGGGCAGCAGCCAAAGACAAGTATCAGCTAGCATCAGGACAGAAAGGTGTCCAAGTACCTGTATCACAGCCGCCTACGCCCACCTAG |
ORF Protein Sequence | MDSPCQPQPLSQALPQLPGSSSEPLEPEPGRARMGVESYLPCPLLPSYHCPGVPSEASAGSGTPRATATSTTASPLRDGFGGQDGGELRPLQSEGAAALVTKGCQRLAAQGARPEAPKRKWAEDGGDAPSPSKRPWARQENQEAEREGGMSCSCSSGSGEASAGLMEEALPSAPERLALDYIVPCMRYYGICVKDSFLGAALGGRVLAEVEALKRGGRLRDGQLVSQRAIPPRSIRGDQIAWVEGHEPGCRSIGALMAHVDAVIRHCAGRLGSYVINGRTKAMVACYPGNGLGYVRHVDNPHGDGRCITCIYYLNQNWDVKVHGGLLQIFPEGRPVVANIEPLFDRLLIFWSDRRNPHEVKPAYATRYAITVWYFDAKERAAAKDKYQLASGQKGVQVPVSQPPTPT |
Reference
Data / case study
Click to get more Data / Case study about the product.
Associated products
Category | Cat No. | Products Name |
---|---|---|
Target Antibody | GM-Tg-g-T53904-Ab | Anti-HPH-1 monoclonal antibody |
Target Antigen | GM-Tg-g-T53904-Ag | HPH-1/EGLN2 protein |
ORF Viral Vector | pGMLP003654 | Human EGLN2 Lentivirus plasmid |
ORF Viral Vector | vGMLP003654 | Human EGLN2 Lentivirus particle |
Target information
Target ID | GM-T53904 |
Target Name | HPH-1 |
Gene ID | 112398, 112406, 114674212, 308457, 101090063, 484495, 536763, 100064859 |
Gene Symbol and Synonyms | 0610011A13Rik,EGLN2,EIT-6,EIT6,Hif-p4h-1,HIF-PH1,HIFPH1,HPH-1,HPH-3,Ier4,PHD-1,PHD1,SM-20 |
Uniprot Accession | Q96KS0 |
Uniprot Entry Name | EGLN2_HUMAN |
Protein Sub-location | Introcelluar Protein |
Category | Therapeutics Target |
Disease | Not Available |
Gene Ensembl | ENSG00000269858 |
Target Classification | Not Available |
The hypoxia inducible factor (HIF) is a transcriptional complex that is involved in oxygen homeostasis. At normal oxygen levels, the alpha subunit of HIF is targeted for degration by prolyl hydroxylation. This gene encodes an enzyme responsible for this post-translational modification. Alternative splicing results in multiple transcript variants. Read-through transcription also exists between this gene and the upstream RAB4B (RAB4B, member RAS oncogene family) gene. [provided by RefSeq, Feb 2011]
About GMVC
GMVC (GM Vector Core) is GeneMedi’s unique platform for QbD Viral vectors Processes development and manufacturing. In GMVC, our core expertise lies in the tailored production of viral vectors, including adeno-associated virus (AAV), lentivirus, and adenovirus. Our state-of-the-art facilities are equipped for scalable manufacturing, ensuring high-quality viral vector production to meet both research and therapeutic needs. Our expert team specializes in process development, leveraging innovative technology and extensive industry knowledge to provide clients with tailored solutions that exceed expectations. GMVC will be the ideal partner for scientists and healthcare professionals seeking reliable and efficient viral vector production services.