Human WNT10A/OODD/ SSPS ORF/cDNA clone-Lentivirus plasmid (NM_025216)
Pre-made Human WNT10A/OODD/ SSPS Lentiviral expression plasmid for WNT10A lentivirus packaging, WNT10A lentivirus production, overexpression stable cell line development, cell transient transfection and gene delivery targeting T/B/NK cells, macrophages, cardiomyocytes, hepatocytes, and neurons.
Our GM-Lentiviral vector is seamlessly integrated with the GM lentivirus packaging system. Discover more about the GM lentivirus packaging system.
Go
to WNT10A/OODD products collection
>>
(antibodies,
antigen, VLP, mRNA, ORF viral vector, etc)
Product information
Catalog No. | Product Name | Plasmid Grade | Plasmid quantity |
---|---|---|---|
pGMLP003668 | Human WNT10A Lentivirus plasmid | Research Grade | 10mg, 50mg, 100mg, 500mg, >1g |
GMP-like Grade | 10mg, 50mg, 100mg, 500mg, >1g | ||
High Quality (HQ) Grade | |||
Seed | 5ug |
Product Description
Catalog ID | pGMLP003668 |
Gene Name | WNT10A |
Accession Number | NM_025216 |
Gene ID | 80326 |
Species | Human |
Product Type | Lentivirus plasmid (overexpression) |
Insert Length | 1254 bp |
Gene Alias | OODD, SSPS, STHAG4 |
Fluorescent Reporter | ZsGreen |
Mammalian Cell Selection | Puromyocin |
Fusion Tag | 3xflag (C-Terminal) |
Promoter | CMV |
Resistance | Amplicin |
Sequence | ATGGGCAGCGCCCACCCTCGCCCCTGGCTGCGGCTCCGACCCCAGCCCCAGCCGCGGCCAGCGCTCTGGGTGCTCCTGTTCTTCCTACTGCTGCTGGCTGCTGCCATGCCCAGGTCAGCACCCAATGACATTCTGGACCTCCGCCTCCCCCCGGAGCCCGTGCTCAATGCCAACACAGTGTGCCTAACATTGCCAGGCCTGAGCCGGCGGCAGATGGAGGTGTGTGTGCGTCACCCTGATGTGGCTGCCTCAGCCATACAGGGCATCCAGATCGCCATCCACGAATGCCAACACCAATTCAGGGACCAGCGCTGGAACTGCTCAAGCCTGGAGACTCGCAACAAGATCCCCTATGAGAGTCCCATCTTCAGCAGAGGTTTCCGAGAGAGCGCTTTTGCCTACGCCATCGCAGCAGCTGGCGTGGTGCACGCCGTGTCCAATGCGTGTGCCCTGGGCAAACTGAAGGCCTGTGGCTGTGATGCGTCCCGGCGAGGGGACGAGGAGGCCTTCCGTAGGAAGCTGCACCGCTTACAACTGGATGCACTGCAGCGTGGTAAGGGCCTGAGCCATGGGGTCCCGGAACACCCAGCCCTGCCCACAGCCAGCCCAGGCCTGCAGGACTCCTGGGAGTGGGGCGGCTGCAGCCCCGACATGGGCTTCGGGGAGCGCTTTTCTAAGGACTTTCTGGACTCCCGGGAGCCTCACAGAGACATCCACGCGAGAATGAGGCTTCACAACAACCGAGTTGGGAGGCAGGCAGTGATGGAGAACATGCGGCGGAAGTGCAAGTGCCACGGCACGTCAGGCAGCTGCCAGCTCAAGACGTGCTGGCAGGTGACGCCCGAGTTCCGCACCGTGGGGGCGCTGCTGCGCAGCCGCTTCCACCGCGCCACGCTCATCCGGCCGCACAACCGCAACGGCGGCCAGCTGGAGCCGGGCCCAGCGGGGGCACCCTCGCCGGCTCCGGGCGCTCCCGGGCCGCGCCGACGGGCCAGCCCCGCCGACCTGGTCTACTTCGAAAAGTCTCCCGACTTCTGCGAGCGCGAGCCGCGCCTGGACTCGGCGGGCACCGTGGGCCGCCTGTGCAACAAGAGCAGCGCCGGCTCGGATGGCTGCGGCAGCATGTGCTGCGGCCGCGGCCACAACATCCTGCGCCAGACGCGCAGCGAGCGCTGCCACTGCCGCTTCCACTGGTGCTGTTTCGTGGTCTGCGAAGAGTGCCGCATCACCGAGTGGGTCAGCGTCTGCAAGTGA |
Reference
Data / case study
Click to get more Data / Case study about the product.
Associated products
Category | Cat No. | Products Name |
---|---|---|
Target Antibody | GM-Tg-g-SE0555-Ab | Anti-WN10A/ WNT10A/ OODD functional antibody |
Target Antigen | GM-Tg-g-SE0555-Ag | WNT10A protein |
Cytokine | cks-Tg-g-GM-SE0555 | wingless-type MMTV integration site family, member 10A (WNT10A) protein & antibody |
ORF Viral Vector | pGMLP003668 | Human WNT10A Lentivirus plasmid |
ORF Viral Vector | vGMLP003668 | Human WNT10A Lentivirus particle |
Target information
Target ID | GM-SE0555 |
Target Name | WNT10A |
Gene ID | 80326, 22409, 700692, 316527, 101092455, 488528, 537330, 111773843 |
Gene Symbol and Synonyms | ECTD16,OODD,SSPS,STHAG4,WNT10A |
Uniprot Accession | Q9GZT5 |
Uniprot Entry Name | WN10A_HUMAN |
Protein Sub-location | Secreted Protein/Potential Cytokines |
Category | Cytokine Target |
Disease | Ovary Cancer |
Gene Ensembl | ENSG00000135925 |
Target Classification | Not Available |
The WNT gene family consists of structurally related genes which encode secreted signaling proteins. These proteins have been implicated in oncogenesis and in several developmental processes, including regulation of cell fate and patterning during embryogenesis. This gene is a member of the WNT gene family. It is strongly expressed in the cell lines of promyelocytic leukemia and Burkitt's lymphoma. In addition, it and another family member, the WNT6 gene, are strongly coexpressed in colorectal cancer cell lines. The gene overexpression may play key roles in carcinogenesis through activation of the WNT-beta-catenin-TCF signaling pathway. This gene and the WNT6 gene are clustered in the chromosome 2q35 region. [provided by RefSeq, Jul 2008]
About GMVC
GMVC (GM Vector Core) is GeneMedi’s unique platform for QbD Viral vectors Processes development and manufacturing. In GMVC, our core expertise lies in the tailored production of viral vectors, including adeno-associated virus (AAV), lentivirus, and adenovirus. Our state-of-the-art facilities are equipped for scalable manufacturing, ensuring high-quality viral vector production to meet both research and therapeutic needs. Our expert team specializes in process development, leveraging innovative technology and extensive industry knowledge to provide clients with tailored solutions that exceed expectations. GMVC will be the ideal partner for scientists and healthcare professionals seeking reliable and efficient viral vector production services.