Human NTSR1/NTR ORF/cDNA clone-Lentivirus plasmid (NM_002531)

Cat. No.: pGMLP003670
Size: 10 µg
Concentration: generally 0.5ug/ul, usually not less than 0.3ug/ul
Leading Time: 3-7 working days

Pre-made Human NTSR1/NTR Lentiviral expression plasmid for NTSR1 lentivirus packaging, NTSR1 lentivirus production, overexpression stable cell line development, cell transient transfection and gene delivery targeting T/B/NK cells, macrophages, cardiomyocytes, hepatocytes, and neurons.

Our GM-Lentiviral vector is seamlessly integrated with the GM lentivirus packaging system. Discover more about the GM lentivirus packaging system.

pdf Datasheet
pdf MSDS
pdf Terms of Use
Target products collection

Go to NTSR1/NTR products collection>>
(antibodies, antigen, VLP, mRNA, ORF viral vector, etc)

Purchase
Total Price: $651.96
Shipping fee: Limited-time free
For payment issues, contact us.


Product Description

Catalog ID pGMLP003670
Gene Name NTSR1
Accession Number NM_002531
Gene ID 4923
Species Human
Product Type Lentivirus plasmid (overexpression)
Insert Length 1257 bp
Gene Alias NTR
Fluorescent Reporter ZsGreen
Mammalian Cell Selection Puromyocin
Fusion Tag 3xflag (C-Terminal)
Promoter CMV
Resistance Amplicin
ORF Nucleotide Sequence ATGCGCCTCAACAGCTCCGCGCCGGGAACCCCGGGCACGCCGGCCGCCGACCCCTTCCAGCGGGCGCAGGCCGGACTGGAGGAGGCGCTGCTGGCCCCGGGCTTCGGCAACGCTTCGGGCAACGCGTCGGAGCGCGTCCTGGCGGCACCCAGCAGCGAGCTGGACGTGAACACCGACATCTACTCCAAGGTGCTGGTGACCGCCGTGTACCTGGCGCTCTTCGTGGTGGGCACGGTGGGCAACACGGTGACGGCGTTCACGCTGGCGCGGAAGAAGTCGCTGCAGAGCCTGCAGAGCACGGTGCATTACCACCTGGGCAGCCTGGCGCTGTCCGACCTGCTCACCCTGCTGCTGGCCATGCCCGTGGAGCTGTACAACTTCATCTGGGTGCACCACCCCTGGGCCTTCGGCGACGCCGGCTGCCGCGGCTACTACTTCCTGCGCGACGCCTGCACCTACGCCACGGCCCTCAACGTGGCCAGCCTGAGTGTGGAGCGCTACCTGGCCATCTGCCACCCCTTCAAGGCCAAGACCCTCATGTCCCGAAGCCGCACCAAGAAGTTCATCAGCGCCATCTGGCTCGCCTCGGCCCTGCTGGCGGTGCCTATGCTGTTCACCATGGGCGAGCAGAACCGCAGCGCCGACGGCCAGCACGCCGGCGGCCTGGTGTGCACCCCCACCATCCACACTGCCACCGTCAAGGTCGTCATACAGGTCAACACCTTCATGTCCTTCATATTCCCCATGGTGGTCATCTCGGTCCTGAACACCATCATCGCCAACAAGCTGACCGTCATGGTACGCCAGGCGGCCGAGCAGGGCCAAGTGTGCACGGTCGGGGGCGAGCACAGCACATTCAGCATGGCCATCGAGCCTGGCAGGGTCCAGGCCCTGCGGCACGGCGTGCGCGTCCTACGTGCAGTGGTCATCGCCTTTGTGGTCTGCTGGCTGCCCTACCACGTGCGGCGCCTCATGTTCTGCTACATCTCGGATGAGCAGTGGACTCCGTTCCTCTATGACTTCTACCACTACTTCTACATGGTGACCAACGCACTCTTCTACGTCAGCTCCACCATCAACCCCATCCTGTACAACCTCGTCTCTGCCAACTTCCGCCACATCTTCCTGGCCACACTGGCCTGCCTCTGCCCGGTGTGGCGGCGCAGGAGGAAGAGGCCAGCCTTCTCGAGGAAGGCCGACAGCGTGTCCAGCAACCACACCCTCTCCAGCAATGCCACCCGCGAGACGCTGTACTAG
ORF Protein Sequence MRLNSSAPGTPGTPAADPFQRAQAGLEEALLAPGFGNASGNASERVLAAPSSELDVNTDIYSKVLVTAVYLALFVVGTVGNTVTAFTLARKKSLQSLQSTVHYHLGSLALSDLLTLLLAMPVELYNFIWVHHPWAFGDAGCRGYYFLRDACTYATALNVASLSVERYLAICHPFKAKTLMSRSRTKKFISAIWLASALLAVPMLFTMGEQNRSADGQHAGGLVCTPTIHTATVKVVIQVNTFMSFIFPMVVISVLNTIIANKLTVMVRQAAEQGQVCTVGGEHSTFSMAIEPGRVQALRHGVRVLRAVVIAFVVCWLPYHVRRLMFCYISDEQWTPFLYDFYHYFYMVTNALFYVSSTINPILYNLVSANFRHIFLATLACLCPVWRRRRKRPAFSRKADSVSSNHTLSSNATRETLY

Reference




    Data / case study


    Click to get more Data / Case study about the product.



    Associated products


    Category Cat No. Products Name
    Target Antibody GM-Tg-g-T02728-Ab Anti-NTR1/ NTSR1/ NTR monoclonal antibody
    Target Antigen GM-Tg-g-T02728-Ag NTSR1 VLP (virus-like particle)
    ORF Viral Vector pGMLP003670 Human NTSR1 Lentivirus plasmid
    ORF Viral Vector vGMLP003670 Human NTSR1 Lentivirus particle


    Target information

    Target ID GM-T02728
    Target Name NTSR1
    Gene ID 4923, 18216, 698936, 366274, 101082643, 485963, 528416, 100051274
    Gene Symbol and Synonyms NT-1R,NTR,NTR-1,NTR1,Ntsr,NTSR1
    Uniprot Accession P30989
    Uniprot Entry Name NTR1_HUMAN
    Protein Sub-location Transmembrane Protein
    Category Therapeutics Target
    Disease Not Available
    Gene Ensembl ENSG00000101188
    Target Classification GPCR

    Neurotensin receptor 1 belongs to the large superfamily of G-protein coupled receptors. NTSR1 mediates the multiple functions of neurotensin, such as hypotension, hyperglycemia, hypothermia, antinociception, and regulation of intestinal motility and secretion. [provided by RefSeq, Jul 2008]



    About GMVC

    GDU

    GMVC (GM Vector Core) is GeneMedi’s unique platform for QbD Viral vectors Processes development and manufacturing. In GMVC, our core expertise lies in the tailored production of viral vectors, including adeno-associated virus (AAV), lentivirus, and adenovirus. Our state-of-the-art facilities are equipped for scalable manufacturing, ensuring high-quality viral vector production to meet both research and therapeutic needs. Our expert team specializes in process development, leveraging innovative technology and extensive industry knowledge to provide clients with tailored solutions that exceed expectations. GMVC will be the ideal partner for scientists and healthcare professionals seeking reliable and efficient viral vector production services.