Human PAX2/FSGS7/PAPRS ORF/cDNA clone-Lentivirus plasmid (NM_003990)

Cat. No.: pGMLP003692
Size: 10 µg
Concentration: generally 0.5ug/ul, usually not less than 0.3ug/ul
Leading Time: 3-7 working days

Pre-made Human PAX2/FSGS7/PAPRS Lentiviral expression plasmid for PAX2 lentivirus packaging, PAX2 lentivirus production, overexpression stable cell line development, cell transient transfection and gene delivery targeting T/B/NK cells, macrophages, cardiomyocytes, hepatocytes, and neurons.

Our GM-Lentiviral vector is seamlessly integrated with the GM lentivirus packaging system. Discover more about the GM lentivirus packaging system.


Target products collection

Go to PAX2/FSGS7 products collection>>
(antibodies, antigen, VLP, mRNA, ORF viral vector, etc)

Purchase
Total Price: $663.72
Shipping fee: Limited-time free
For payment issues, contact us.


Product Description

Catalog ID pGMLP003692
Gene Name PAX2
Accession Number NM_003990
Gene ID 5076
Species Human
Product Type Lentivirus plasmid (overexpression)
Insert Length 1299 bp
Gene Alias FSGS7,PAPRS
Fluorescent Reporter ZsGreen
Mammalian Cell Selection Puromyocin
Fusion Tag 3xflag (C-Terminal)
Promoter CMV
Resistance Amplicin
ORF Nucleotide Sequence ATGGATATGCACTGCAAAGCAGACCCCTTCTCCGCGATGCACCCAGGGCACGGGGGTGTGAACCAGCTCGGGGGGGTGTTTGTGAACGGCCGGCCCCTACCCGACGTGGTGAGGCAGCGCATCGTGGAGCTGGCCCACCAGGGTGTGCGGCCCTGTGACATCTCCCGGCAGCTGCGGGTCAGCCACGGCTGTGTCAGCAAAATCCTGGGCAGGTACTACGAGACCGGCAGCATCAAGCCGGGTGTGATCGGTGGCTCCAAGCCCAAAGTGGCGACGCCCAAAGTGGTGGACAAGATTGCTGAATACAAACGACAGAACCCGACTATGTTCGCCTGGGAGATTCGAGACCGGCTCCTGGCCGAGGGCATCTGTGACAATGACACAGTGCCCAGCGTCTCTTCCATCAACAGAATCATCCGGACCAAAGTTCAGCAGCCTTTCCACCCAACGCCGGATGGGGCTGGGACAGGAGTGACCGCCCCTGGCCACACCATTGTTCCCAGCACGGCCTCCCCTCCTGTTTCCAGCGCCTCCAATGACCCAGTGGGATCCTACTCCATCAATGGGATCCTGGGGATTCCTCGCTCCAATGGTGAGAAGAGGAAACGTGATGAAGTTGAGGTATACACTGATCCTGCCCACATTAGAGGAGGTGGAGGTTTGCATCTGGTCTGGACTTTAAGAGATGTGTCTGAGGGCTCAGTCCCCAATGGAGATTCCCAGAGTGGTGTGGACAGTTTGCGGAAGCACTTGCGAGCTGACACCTTCACCCAGCAGCAGCTGGAAGCTTTGGATCGGGTCTTTGAGCGTCCTTCCTACCCTGACGTCTTCCAGGCATCAGAGCACATCAAATCAGAACAGGGGAACGAGTACTCCCTCCCAGCCCTGACCCCTGGGCTTGATGAAGTCAAGTCGAGTCTATCTGCATCCACCAACCCTGAGCTGGGCAGCAACGTGTCAGGCACACAGACATACCCAGTTGTGACTGGTCGTGACATGGCGAGCACCACTCTGCCTGGTTACCCCCCTCACGTGCCCCCCACTGGCCAGGGAAGCTACCCCACCTCCACCCTGGCAGGAATGGTGCCTGGGAGCGAGTTCTCCGGCAACCCGTACAGCCACCCCCAGTACACGGCCTACAACGAGGCTTGGAGATTCAGCAACCCCGCCTTACTAATGCCGCCCCCCGGGGCTCCGCCCCTGCCGCTGCTGCCGCTGCCTATGACCGCCACTAGTTACCGCGGGGACCACATCAAGCTTCAGGCCGACAGCTTCGGCCTCCACATCGTCCCCGTCTGA
ORF Protein Sequence MDMHCKADPFSAMHPGHGGVNQLGGVFVNGRPLPDVVRQRIVELAHQGVRPCDISRQLRVSHGCVSKILGRYYETGSIKPGVIGGSKPKVATPKVVDKIAEYKRQNPTMFAWEIRDRLLAEGICDNDTVPSVSSINRIIRTKVQQPFHPTPDGAGTGVTAPGHTIVPSTASPPVSSASNDPVGSYSINGILGIPRSNGEKRKRDEVEVYTDPAHIRGGGGLHLVWTLRDVSEGSVPNGDSQSGVDSLRKHLRADTFTQQQLEALDRVFERPSYPDVFQASEHIKSEQGNEYSLPALTPGLDEVKSSLSASTNPELGSNVSGTQTYPVVTGRDMASTTLPGYPPHVPPTGQGSYPTSTLAGMVPGSEFSGNPYSHPQYTAYNEAWRFSNPALLMPPPGAPPLPLLPLPMTATSYRGDHIKLQADSFGLHIVPV

Reference




    Data / case study


    Click to get more Data / Case study about the product.



    Associated products


    Category Cat No. Products Name
    Target Antibody GM-Tg-g-SE1419-Ab Anti-PAX2/ FSGS7/ PAPRS functional antibody
    Target Antigen GM-Tg-g-SE1419-Ag PAX2 protein
    ORF Viral Vector pGMLP003692 Human PAX2 Lentivirus plasmid
    ORF Viral Vector pGMLV001793 Human PAX2 Lentivirus plasmid
    ORF Viral Vector pGMAD001105 Human PAX2 Adenovirus plasmid
    ORF Viral Vector vGMLP003692 Human PAX2 Lentivirus particle
    ORF Viral Vector vGMLV001793 Human PAX2 Lentivirus particle
    ORF Viral Vector vGMAD001105 Human PAX2 Adenovirus particle


    Target information

    Target ID GM-SE1419
    Target Name PAX2
    Gene ID 5076, 18504, 710687, 293992, 101092147, 609228, 100297382, 100070326
    Gene Symbol and Synonyms FSGS7,Opdc,PAPRS,PAX-2,PAX2
    Uniprot Accession Q02962
    Uniprot Entry Name PAX2_HUMAN
    Protein Sub-location Secreted Protein/Potential Cytokines
    Category Not Available
    Disease Cancer
    Gene Ensembl ENSG00000075891
    Target Classification Tumor-associated antigen (TAA)

    PAX2 encodes paired box gene 2, one of many human homologues of the Drosophila melanogaster gene prd. The central feature of this transcription factor gene family is the conserved DNA-binding paired box domain. PAX2 is believed to be a target of transcriptional supression by the tumor suppressor gene WT1. Mutations within PAX2 have been shown to result in optic nerve colobomas and renal hypoplasia. Alternative splicing of this gene results in multiple transcript variants. [provided by RefSeq, Dec 2014]



    About GMVC

    GDU

    GMVC (GM Vector Core) is GeneMedi’s unique platform for QbD Viral vectors Processes development and manufacturing. In GMVC, our core expertise lies in the tailored production of viral vectors, including adeno-associated virus (AAV), lentivirus, and adenovirus. Our state-of-the-art facilities are equipped for scalable manufacturing, ensuring high-quality viral vector production to meet both research and therapeutic needs. Our expert team specializes in process development, leveraging innovative technology and extensive industry knowledge to provide clients with tailored solutions that exceed expectations. GMVC will be the ideal partner for scientists and healthcare professionals seeking reliable and efficient viral vector production services.