Human PAX2/FSGS7/ PAPRS ORF/cDNA clone-Lentivirus plasmid (NM_003990)
Pre-made Human PAX2/FSGS7/ PAPRS Lentiviral expression plasmid for PAX2 lentivirus packaging, PAX2 lentivirus production, overexpression stable cell line development, cell transient transfection and gene delivery targeting T/B/NK cells, macrophages, cardiomyocytes, hepatocytes, and neurons.
Our GM-Lentiviral vector is seamlessly integrated with the GM lentivirus packaging system. Discover more about the GM lentivirus packaging system.
Go
to PAX2/FSGS7 products collection
>>
(antibodies,
antigen, VLP, mRNA, ORF viral vector, etc)
Product information
Catalog No. | Product Name | Plasmid Grade | Plasmid quantity |
---|---|---|---|
pGMLP003692 | Human PAX2 Lentivirus plasmid | Research Grade | 10mg, 50mg, 100mg, 500mg, >1g |
GMP-like Grade | 10mg, 50mg, 100mg, 500mg, >1g | ||
High Quality (HQ) Grade | |||
Seed | 5ug |
Product Description
Catalog ID | pGMLP003692 |
Gene Name | PAX2 |
Accession Number | NM_003990 |
Gene ID | 5076 |
Species | Human |
Product Type | Lentivirus plasmid (overexpression) |
Insert Length | 1299 bp |
Gene Alias | FSGS7, PAPRS |
Fluorescent Reporter | ZsGreen |
Mammalian Cell Selection | Puromyocin |
Fusion Tag | 3xflag (C-Terminal) |
Promoter | CMV |
Resistance | Amplicin |
Sequence | ATGGATATGCACTGCAAAGCAGACCCCTTCTCCGCGATGCACCCAGGGCACGGGGGTGTGAACCAGCTCGGGGGGGTGTTTGTGAACGGCCGGCCCCTACCCGACGTGGTGAGGCAGCGCATCGTGGAGCTGGCCCACCAGGGTGTGCGGCCCTGTGACATCTCCCGGCAGCTGCGGGTCAGCCACGGCTGTGTCAGCAAAATCCTGGGCAGGTACTACGAGACCGGCAGCATCAAGCCGGGTGTGATCGGTGGCTCCAAGCCCAAAGTGGCGACGCCCAAAGTGGTGGACAAGATTGCTGAATACAAACGACAGAACCCGACTATGTTCGCCTGGGAGATTCGAGACCGGCTCCTGGCCGAGGGCATCTGTGACAATGACACAGTGCCCAGCGTCTCTTCCATCAACAGAATCATCCGGACCAAAGTTCAGCAGCCTTTCCACCCAACGCCGGATGGGGCTGGGACAGGAGTGACCGCCCCTGGCCACACCATTGTTCCCAGCACGGCCTCCCCTCCTGTTTCCAGCGCCTCCAATGACCCAGTGGGATCCTACTCCATCAATGGGATCCTGGGGATTCCTCGCTCCAATGGTGAGAAGAGGAAACGTGATGAAGTTGAGGTATACACTGATCCTGCCCACATTAGAGGAGGTGGAGGTTTGCATCTGGTCTGGACTTTAAGAGATGTGTCTGAGGGCTCAGTCCCCAATGGAGATTCCCAGAGTGGTGTGGACAGTTTGCGGAAGCACTTGCGAGCTGACACCTTCACCCAGCAGCAGCTGGAAGCTTTGGATCGGGTCTTTGAGCGTCCTTCCTACCCTGACGTCTTCCAGGCATCAGAGCACATCAAATCAGAACAGGGGAACGAGTACTCCCTCCCAGCCCTGACCCCTGGGCTTGATGAAGTCAAGTCGAGTCTATCTGCATCCACCAACCCTGAGCTGGGCAGCAACGTGTCAGGCACACAGACATACCCAGTTGTGACTGGTCGTGACATGGCGAGCACCACTCTGCCTGGTTACCCCCCTCACGTGCCCCCCACTGGCCAGGGAAGCTACCCCACCTCCACCCTGGCAGGAATGGTGCCTGGGAGCGAGTTCTCCGGCAACCCGTACAGCCACCCCCAGTACACGGCCTACAACGAGGCTTGGAGATTCAGCAACCCCGCCTTACTAATGCCGCCCCCCGGGGCTCCGCCCCTGCCGCTGCTGCCGCTGCCTATGACCGCCACTAGTTACCGCGGGGACCACATCAAGCTTCAGGCCGACAGCTTCGGCCTCCACATCGTCCCCGTCTGA |
Reference
Data / case study
Click to get more Data / Case study about the product.
Associated products
Category | Cat No. | Products Name |
---|---|---|
Target Antibody | GM-Tg-g-SE1419-Ab | Anti-PAX2/ FSGS7/ PAPRS functional antibody |
Target Antigen | GM-Tg-g-SE1419-Ag | PAX2 protein |
ORF Viral Vector | pGMLV001793 | Human PAX2 Lentivirus plasmid |
ORF Viral Vector | pGMAD001105 | Human PAX2 Adenovirus plasmid |
ORF Viral Vector | pGMLP003692 | Human PAX2 Lentivirus plasmid |
ORF Viral Vector | vGMLV001793 | Human PAX2 Lentivirus particle |
ORF Viral Vector | vGMAD001105 | Human PAX2 Adenovirus particle |
ORF Viral Vector | vGMLP003692 | Human PAX2 Lentivirus particle |
Target information
Target ID | GM-SE1419 |
Target Name | PAX2 |
Gene ID | 5076, 18504, 710687, 293992, 101092147, 609228, 100297382, 100070326 |
Gene Symbol and Synonyms | FSGS7,Opdc,PAPRS,PAX-2,PAX2 |
Uniprot Accession | Q02962 |
Uniprot Entry Name | PAX2_HUMAN |
Protein Sub-location | Secreted Protein/Potential Cytokines |
Category | Not Available |
Disease | Cancer |
Gene Ensembl | ENSG00000075891 |
Target Classification | Tumor-associated antigen (TAA) |
PAX2 encodes paired box gene 2, one of many human homologues of the Drosophila melanogaster gene prd. The central feature of this transcription factor gene family is the conserved DNA-binding paired box domain. PAX2 is believed to be a target of transcriptional supression by the tumor suppressor gene WT1. Mutations within PAX2 have been shown to result in optic nerve colobomas and renal hypoplasia. Alternative splicing of this gene results in multiple transcript variants. [provided by RefSeq, Dec 2014]
About GMVC
GMVC (GM Vector Core) is GeneMedi’s unique platform for QbD Viral vectors Processes development and manufacturing. In GMVC, our core expertise lies in the tailored production of viral vectors, including adeno-associated virus (AAV), lentivirus, and adenovirus. Our state-of-the-art facilities are equipped for scalable manufacturing, ensuring high-quality viral vector production to meet both research and therapeutic needs. Our expert team specializes in process development, leveraging innovative technology and extensive industry knowledge to provide clients with tailored solutions that exceed expectations. GMVC will be the ideal partner for scientists and healthcare professionals seeking reliable and efficient viral vector production services.