Human KCNJ4/HIR/HIRK2 ORF/cDNA clone-Lentivirus plasmid (NM_004981)

Cat. No.: pGMLP003705
Size: 10 µg
Concentration: generally 0.5ug/ul, usually not less than 0.3ug/ul
Leading Time: 3-7 working days

Pre-made Human KCNJ4/HIR/HIRK2 Lentiviral expression plasmid for KCNJ4 lentivirus packaging, KCNJ4 lentivirus production, overexpression stable cell line development, cell transient transfection and gene delivery targeting T/B/NK cells, macrophages, cardiomyocytes, hepatocytes, and neurons.

Our GM-Lentiviral vector is seamlessly integrated with the GM lentivirus packaging system. Discover more about the GM lentivirus packaging system.

pdf Datasheet
pdf MSDS
pdf Terms of Use
Target products collection

Go to KCNJ4/HIR products collection>>
(antibodies, antigen, VLP, mRNA, ORF viral vector, etc)

Purchase
Total Price: $674.64
Shipping fee: Limited-time free
For payment issues, contact us.


Product Description

Catalog ID pGMLP003705
Gene Name KCNJ4
Accession Number NM_004981
Gene ID 3761
Species Human
Product Type Lentivirus plasmid (overexpression)
Insert Length 1338 bp
Gene Alias HIR,HIRK2,HRK1,IRK-3,IRK3,Kir2.3
Fluorescent Reporter ZsGreen
Mammalian Cell Selection Puromyocin
Fusion Tag 3xflag (C-Terminal)
Promoter CMV
Resistance Amplicin
ORF Nucleotide Sequence ATGCACGGACACAGCCGCAACGGCCAGGCCCACGTGCCCCGGCGGAAGCGCCGCAACCGCTTCGTCAAGAAGAACGGCCAATGCAACGTGTACTTCGCCAACCTGAGCAACAAGTCGCAGCGCTACATGGCGGACATCTTCACCACCTGCGTGGACACGCGCTGGCGCTACATGCTCATGATCTTCTCCGCGGCCTTCCTTGTCTCCTGGCTCTTTTTCGGCCTCCTCTTCTGGTGTATCGCCTTCTTCCACGGTGACCTGGAGGCCAGCCCAGGGGTGCCTGCGGCGGGGGGCCCGGCGGCGGGTGGTGGCGGAGCAGCCCCGGTGGCCCCCAAGCCCTGCATCATGCACGTGAACGGCTTCCTGGGTGCCTTCCTGTTCTCGGTGGAGACGCAGACGACCATCGGCTATGGGTTCCGGTGCGTGACAGAGGAGTGCCCGCTGGCAGTCATCGCTGTGGTGGTCCAGTCCATCGTGGGCTGCGTCATCGACTCCTTCATGATTGGCACCATCATGGCCAAGATGGCGCGGCCCAAGAAGCGGGCGCAGACGTTGCTGTTCAGCCACCACGCGGTCATTTCGGTGCGCGACGGCAAGCTCTGCCTCATGTGGCGCGTGGGCAACCTGCGCAAGAGCCACATTGTGGAGGCCCACGTGCGGGCCCAGCTCATCAAGCCCTACATGACCCAGGAGGGCGAGTACCTGCCCCTGGACCAGCGGGACCTCAACGTGGGCTATGACATCGGCCTGGACCGCATCTTCCTGGTGTCGCCCATCATCATTGTCCACGAGATCGACGAGGACAGCCCGCTTTATGGCATGGGCAAGGAGGAGCTGGAGTCGGAGGACTTTGAGATCGTGGTCATCCTGGAGGGCATGGTGGAGGCCACGGCCATGACCACCCAGGCCCGCAGCTCCTACCTGGCCAGCGAGATCCTGTGGGGCCACCGCTTTGAGCCTGTGGTCTTCGAGGAGAAGAGCCACTACAAGGTGGACTACTCACGTTTTCACAAGACCTACGAGGTGGCCGGCACGCCCTGCTGCTCGGCCCGGGAGCTGCAGGAGAGTAAGATCACCGTGCTGCCCGCCCCACCGCCCCCTCCCAGTGCCTTCTGCTACGAGAACGAGCTGGCCCTTATGAGCCAGGAGGAAGAGGAGATGGAGGAGGAGGCAGCTGCGGCGGCCGCGGTGGCCGCAGGCCTGGGCCTGGAGGCGGGTTCCAAGGAGGAGGCGGGCATCATCCGGATGCTGGAGTTCGGCAGCCACCTGGACCTGGAGCGCATGCAGGCTTCCCTCCCGCTGGACAACATCTCCTACCGCAGGGAGTCTGCCATCTGA
ORF Protein Sequence MHGHSRNGQAHVPRRKRRNRFVKKNGQCNVYFANLSNKSQRYMADIFTTCVDTRWRYMLMIFSAAFLVSWLFFGLLFWCIAFFHGDLEASPGVPAAGGPAAGGGGAAPVAPKPCIMHVNGFLGAFLFSVETQTTIGYGFRCVTEECPLAVIAVVVQSIVGCVIDSFMIGTIMAKMARPKKRAQTLLFSHHAVISVRDGKLCLMWRVGNLRKSHIVEAHVRAQLIKPYMTQEGEYLPLDQRDLNVGYDIGLDRIFLVSPIIIVHEIDEDSPLYGMGKEELESEDFEIVVILEGMVEATAMTTQARSSYLASEILWGHRFEPVVFEEKSHYKVDYSRFHKTYEVAGTPCCSARELQESKITVLPAPPPPPSAFCYENELALMSQEEEEMEEEAAAAAAVAAGLGLEAGSKEEAGIIRMLEFGSHLDLERMQASLPLDNISYRRESAI

Reference




    Data / case study


    Click to get more Data / Case study about the product.



    Associated products


    Category Cat No. Products Name
    Target Antibody GM-Tg-g-T07740-Ab Anti-KCNJ4/ HIR/ HIRK2 monoclonal antibody
    Target Antigen GM-Tg-g-T07740-Ag KCNJ4 VLP (virus-like particle)
    ORF Viral Vector pGMLP003705 Human KCNJ4 Lentivirus plasmid
    ORF Viral Vector vGMLP003705 Human KCNJ4 Lentivirus particle


    Target information

    Target ID GM-T07740
    Target Name KCNJ4
    Gene ID 3761, 16520, 721015, 116649, 101101573, 481253, 101906792, 100070031
    Gene Symbol and Synonyms HIR,HIRK2,HRK1,IRK-3,IRK3,Kcnf2,KCNJ4,Kir2.3,MB-IRK3
    Uniprot Accession P48050
    Uniprot Entry Name KCNJ4_HUMAN
    Protein Sub-location Transmembrane Protein
    Category Therapeutics Target
    Disease Not Available
    Gene Ensembl ENSG00000168135
    Target Classification Not Available

    Several different potassium channels are known to be involved with electrical signaling in the nervous system. One class is activated by depolarization whereas a second class is not. The latter are referred to as inwardly rectifying K+ channels, and they have a greater tendency to allow potassium to flow into the cell rather than out of it. This asymmetry in potassium ion conductance plays a key role in the excitability of muscle cells and neurons. The protein encoded by this gene is an integral membrane protein and member of the inward rectifier potassium channel family. The encoded protein has a small unitary conductance compared to other members of this protein family. Two transcript variants encoding the same protein have been found for this gene. [provided by RefSeq, Jul 2008]



    About GMVC

    GDU

    GMVC (GM Vector Core) is GeneMedi’s unique platform for QbD Viral vectors Processes development and manufacturing. In GMVC, our core expertise lies in the tailored production of viral vectors, including adeno-associated virus (AAV), lentivirus, and adenovirus. Our state-of-the-art facilities are equipped for scalable manufacturing, ensuring high-quality viral vector production to meet both research and therapeutic needs. Our expert team specializes in process development, leveraging innovative technology and extensive industry knowledge to provide clients with tailored solutions that exceed expectations. GMVC will be the ideal partner for scientists and healthcare professionals seeking reliable and efficient viral vector production services.