Human GLP1R/GLP-1/GLP-1-R ORF/cDNA clone-Lentivirus plasmid (NM_002062)

Cat. No.: pGMLP003729
Size: 10 µg
Concentration: generally 0.5ug/ul, usually not less than 0.3ug/ul
Leading Time: 3-7 working days

Pre-made Human GLP1R/GLP-1/GLP-1-R Lentiviral expression plasmid for GLP1R lentivirus packaging, GLP1R lentivirus production, overexpression stable cell line development, cell transient transfection and gene delivery targeting T/B/NK cells, macrophages, cardiomyocytes, hepatocytes, and neurons.

Our GM-Lentiviral vector is seamlessly integrated with the GM lentivirus packaging system. Discover more about the GM lentivirus packaging system.


Target products collection

Go to GLP1R/GLP-1 products collection>>
(antibodies, antigen, VLP, mRNA, ORF viral vector, etc)

Purchase
Total Price: $689.76
Shipping fee: Limited-time free
For payment issues, contact us.


Product Description

Catalog ID pGMLP003729
Gene Name GLP1R
Accession Number NM_002062
Gene ID 2740
Species Human
Product Type Lentivirus plasmid (overexpression)
Insert Length 1392 bp
Gene Alias GLP-1,GLP-1-R,GLP-1R
Fluorescent Reporter ZsGreen
Mammalian Cell Selection Puromyocin
Fusion Tag 3xflag (C-Terminal)
Promoter CMV
Resistance Amplicin
ORF Nucleotide Sequence ATGGCCGGCGCCCCCGGCCCGCTGCGCCTTGCGCTGCTGCTGCTCGGGATGGTGGGCAGGGCCGGCCCCCGCCCCCAGGGTGCCACTGTGTCCCTCTGGGAGACGGTGCAGAAATGGCGAGAATACCGACGCCAGTGCCAGCGCTCCCTGACTGAGGATCCACCTCCTGCCACAGACTTGTTCTGCAACCGGACCTTCGATGAATACGCCTGCTGGCCAGATGGGGAGCCAGGCTCGTTCGTGAATGTCAGCTGCCCCTGGTACCTGCCCTGGGCCAGCAGTGTGCCGCAGGGCCACGTGTACCGGTTCTGCACAGCTGAAGGCCTCTGGCTGCAGAAGGACAACTCCAGCCTGCCCTGGAGGGACTTGTCGGAGTGCGAGGAGTCCAAGCGAGGGGAAAGAAGCTCCCCGGAGGAGCAGCTCCTGTTCCTCTACATCATCTACACGGTGGGCTACGCACTCTCCTTCTCTGCTCTGGTTATCGCCTCTGCGATCCTCCTCGGCTTCAGACACCTGCACTGCACCAGGAACTACATCCACCTGAACCTGTTTGCATCCTTCATCCTGCGAGCATTGTCCGTCTTCATCAAGGACGCAGCCCTGAAGTGGATGTATAGCACAGCCGCCCAGCAGCACCAGTGGGATGGGCTCCTCTCCTACCAGGACTCTCTGAGCTGCCGCCTGGTGTTTCTGCTCATGCAGTACTGTGTGGCGGCCAATTACTACTGGCTCTTGGTGGAGGGCGTGTACCTGTACACACTGCTGGCCTTCTCGGTCTTATCTGAGCAATGGATCTTCAGGCTCTACGTGAGCATAGGCTGGGGTGTTCCCCTGCTGTTTGTTGTCCCCTGGGGCATTGTCAAGTACCTCTATGAGGACGAGGGCTGCTGGACCAGGAACTCCAACATGAACTACTGGCTCATTATCCGGCTGCCCATTCTCTTTGCCATTGGGGTGAACTTCCTCATCTTTGTTCGGGTCATCTGCATCGTGGTATCCAAACTGAAGGCCAATCTCATGTGCAAGACAGACATCAAATGCAGACTTGCCAAGTCCACGCTGACACTCATCCCCCTGCTGGGGACTCATGAGGTCATCTTTGCCTTTGTGATGGACGAGCACGCCCGGGGGACCCTGCGCTTCATCAAGCTGTTTACAGAGCTCTCCTTCACCTCCTTCCAGGGGCTGATGGTGGCCATATTATACTGCTTTGTCAACAATGAGGTCCAGCTGGAATTTCGGAAGAGCTGGGAGCGCTGGCGGCTTGAGCACTTGCACATCCAGAGGGACAGCAGCATGAAGCCCCTCAAGTGTCCCACCAGCAGCCTGAGCAGTGGAGCCACGGCGGGCAGCAGCATGTACACAGCCACTTGCCAGGCCTCCTGCAGCTGA
ORF Protein Sequence MAGAPGPLRLALLLLGMVGRAGPRPQGATVSLWETVQKWREYRRQCQRSLTEDPPPATDLFCNRTFDEYACWPDGEPGSFVNVSCPWYLPWASSVPQGHVYRFCTAEGLWLQKDNSSLPWRDLSECEESKRGERSSPEEQLLFLYIIYTVGYALSFSALVIASAILLGFRHLHCTRNYIHLNLFASFILRALSVFIKDAALKWMYSTAAQQHQWDGLLSYQDSLSCRLVFLLMQYCVAANYYWLLVEGVYLYTLLAFSVLSEQWIFRLYVSIGWGVPLLFVVPWGIVKYLYEDEGCWTRNSNMNYWLIIRLPILFAIGVNFLIFVRVICIVVSKLKANLMCKTDIKCRLAKSTLTLIPLLGTHEVIFAFVMDEHARGTLRFIKLFTELSFTSFQGLMVAILYCFVNNEVQLEFRKSWERWRLEHLHIQRDSSMKPLKCPTSSLSSGATAGSSMYTATCQASCS

Reference




    Data / case study


    Click to get more Data / Case study about the product.



    Associated products


    Category Cat No. Products Name
    Biosimilar GMP-Bios-INN-895
    Biosimilar GMP-Bios-INN-724 Pre-Made Albiglutide Biosimilar, Peptide Protein Fusion targeting GLP1R: (Glp-1)2 Peptide-Albumin(Alb) Fusion Protein targetingGLP-1-R/GLP-1R
    Biosimilar GMP-Bios-INN-824
    Biosimilar GMP-Bios-INN-817
    Biosimilar GMP-Bios-INN-806 Pre-Made Dulaglutide Biosimilar, Peptide Protein Fusion targeting GLP1R: (Glp-12) Peptide-Human Igg4 Fc Fusion Protein targeting GLP-1/GLP-1-R/GLP-1R
    Target Antibody GM-Tg-g-T36075-Ab Anti-GLP1R/ GLP-1/ GLP-1-R monoclonal antibody
    Target Antigen GM-Tg-g-T36075-Ag GLP1R VLP (virus-like particle)
    ORF Viral Vector pGMLP003729 Human GLP1R Lentivirus plasmid
    ORF Viral Vector vGMLP003729 Human GLP1R Lentivirus particle


    Target information

    Target ID GM-T36075
    Target Name GLP1R
    Gene ID 2740, 14652, 719548, 25051, 101095495, 481778, 517420, 100065307
    Gene Symbol and Synonyms Glip,GLP-1,GLP-1-R,GLP-1R,GLP1R,GLP1Rc,RATGL1RCP
    Uniprot Accession P43220
    Uniprot Entry Name GLP1R_HUMAN
    Protein Sub-location Transmembrane Protein
    Category Therapeutics Target, INN Index
    Disease Not Available
    Gene Ensembl ENSG00000112164
    Target Classification GPCR

    This gene encodes a 7-transmembrane protein that functions as a receptor for glucagon-like peptide 1 (GLP-1) hormone, which stimulates glucose-induced insulin secretion. This receptor, which functions at the cell surface, becomes internalized in response to GLP-1 and GLP-1 analogs, and it plays an important role in the signaling cascades leading to insulin secretion. It also displays neuroprotective effects in animal models. Polymorphisms in this gene are associated with diabetes. The protein is an important drug target for the treatment of type 2 diabetes and stroke. Alternative splicing of this gene results in multiple transcript variants. [provided by RefSeq, Apr 2016]



    About GMVC

    GDU

    GMVC (GM Vector Core) is GeneMedi’s unique platform for QbD Viral vectors Processes development and manufacturing. In GMVC, our core expertise lies in the tailored production of viral vectors, including adeno-associated virus (AAV), lentivirus, and adenovirus. Our state-of-the-art facilities are equipped for scalable manufacturing, ensuring high-quality viral vector production to meet both research and therapeutic needs. Our expert team specializes in process development, leveraging innovative technology and extensive industry knowledge to provide clients with tailored solutions that exceed expectations. GMVC will be the ideal partner for scientists and healthcare professionals seeking reliable and efficient viral vector production services.