- • Up to 20%-50%* off first purchase
- • Bulk quantities available
- • Citation Reward application
Sample Application
- • Animal health test
- • In-vitro diagnostics
- • Food & Feed Safety
- • Environmental Safety
- • New drug discovery
Supports
- Talk to our Expert:
[email protected] -
Talk to our sales:
[email protected]
Protocol Library Download
 |
 |
Human GLP1R/GLP-1/ GLP-1-R ORF/cDNA clone-Lentivirus plasmid (NM_002062)
Pre-made Human GLP1R/GLP-1/ GLP-1-R Lentiviral expression plasmid for GLP1R lentivirus packaging, GLP1R lentivirus production, overexpression stable cell line development, cell transient transfection and gene delivery targeting T/B/NK cells, macrophages, cardiomyocytes, hepatocytes, and neurons.
Our GM-Lentiviral vector is seamlessly integrated with the GM lentivirus packaging system. Discover more about the GM lentivirus packaging system.
Go
to GLP1R/GLP-1 products collection
>>
(antibodies,
antigen, VLP, mRNA, ORF viral vector, etc)
Product information
| Catalog No. | Product Name | Plasmid Grade | Plasmid quantity |
|---|---|---|---|
| pGMLP003729 | Human GLP1R Lentivirus plasmid | Research Grade | 10mg, 50mg, 100mg, 500mg, >1g |
| GMP-like Grade | 10mg, 50mg, 100mg, 500mg, >1g | ||
| High Quality (HQ) Grade | |||
| Seed | 5ug |
Product Description
| Catalog ID | pGMLP003729 |
| Gene Name | GLP1R |
| Accession Number | NM_002062 |
| Gene ID | 2740 |
| Species | Human |
| Product Type | Lentivirus plasmid (overexpression) |
| Insert Length | 1392 bp |
| Gene Alias | GLP-1, GLP-1-R, GLP-1R |
| Fluorescent Reporter | ZsGreen |
| Mammalian Cell Selection | Puromyocin |
| Fusion Tag | 3xflag (C-Terminal) |
| Promoter | CMV |
| Resistance | Amplicin |
| Sequence | ATGGCCGGCGCCCCCGGCCCGCTGCGCCTTGCGCTGCTGCTGCTCGGGATGGTGGGCAGGGCCGGCCCCCGCCCCCAGGGTGCCACTGTGTCCCTCTGGGAGACGGTGCAGAAATGGCGAGAATACCGACGCCAGTGCCAGCGCTCCCTGACTGAGGATCCACCTCCTGCCACAGACTTGTTCTGCAACCGGACCTTCGATGAATACGCCTGCTGGCCAGATGGGGAGCCAGGCTCGTTCGTGAATGTCAGCTGCCCCTGGTACCTGCCCTGGGCCAGCAGTGTGCCGCAGGGCCACGTGTACCGGTTCTGCACAGCTGAAGGCCTCTGGCTGCAGAAGGACAACTCCAGCCTGCCCTGGAGGGACTTGTCGGAGTGCGAGGAGTCCAAGCGAGGGGAAAGAAGCTCCCCGGAGGAGCAGCTCCTGTTCCTCTACATCATCTACACGGTGGGCTACGCACTCTCCTTCTCTGCTCTGGTTATCGCCTCTGCGATCCTCCTCGGCTTCAGACACCTGCACTGCACCAGGAACTACATCCACCTGAACCTGTTTGCATCCTTCATCCTGCGAGCATTGTCCGTCTTCATCAAGGACGCAGCCCTGAAGTGGATGTATAGCACAGCCGCCCAGCAGCACCAGTGGGATGGGCTCCTCTCCTACCAGGACTCTCTGAGCTGCCGCCTGGTGTTTCTGCTCATGCAGTACTGTGTGGCGGCCAATTACTACTGGCTCTTGGTGGAGGGCGTGTACCTGTACACACTGCTGGCCTTCTCGGTCTTATCTGAGCAATGGATCTTCAGGCTCTACGTGAGCATAGGCTGGGGTGTTCCCCTGCTGTTTGTTGTCCCCTGGGGCATTGTCAAGTACCTCTATGAGGACGAGGGCTGCTGGACCAGGAACTCCAACATGAACTACTGGCTCATTATCCGGCTGCCCATTCTCTTTGCCATTGGGGTGAACTTCCTCATCTTTGTTCGGGTCATCTGCATCGTGGTATCCAAACTGAAGGCCAATCTCATGTGCAAGACAGACATCAAATGCAGACTTGCCAAGTCCACGCTGACACTCATCCCCCTGCTGGGGACTCATGAGGTCATCTTTGCCTTTGTGATGGACGAGCACGCCCGGGGGACCCTGCGCTTCATCAAGCTGTTTACAGAGCTCTCCTTCACCTCCTTCCAGGGGCTGATGGTGGCCATATTATACTGCTTTGTCAACAATGAGGTCCAGCTGGAATTTCGGAAGAGCTGGGAGCGCTGGCGGCTTGAGCACTTGCACATCCAGAGGGACAGCAGCATGAAGCCCCTCAAGTGTCCCACCAGCAGCCTGAGCAGTGGAGCCACGGCGGGCAGCAGCATGTACACAGCCACTTGCCAGGCCTCCTGCAGCTGA |
Reference
Data / case study
Click to get more Data / Case study about the product.
Associated products
| Category | Cat No. | Products Name |
|---|---|---|
| Biosimilar | GMP-Bios-INN-895 | |
| Biosimilar | GMP-Bios-INN-724 | Pre-Made Albiglutide Biosimilar, Peptide Protein Fusion targeting GLP1R: (Glp-1)2 Peptide-Albumin(Alb) Fusion Protein targetingGLP-1-R/GLP-1R |
| Biosimilar | GMP-Bios-INN-824 | |
| Biosimilar | GMP-Bios-INN-817 | |
| Biosimilar | GMP-Bios-INN-806 | Pre-Made Dulaglutide Biosimilar, Peptide Protein Fusion targeting GLP1R: (Glp-12) Peptide-Human Igg4 Fc Fusion Protein targeting GLP-1/GLP-1-R/GLP-1R |
| Target Antibody | GM-Tg-g-T36075-Ab | Anti-GLP1R/ GLP-1/ GLP-1-R monoclonal antibody |
| Target Antigen | GM-Tg-g-T36075-Ag | GLP1R VLP (virus-like particle) |
| ORF Viral Vector | pGMLP003729 | Human GLP1R Lentivirus plasmid |
| ORF Viral Vector | vGMLP003729 | Human GLP1R Lentivirus particle |
Target information
| Target ID | GM-T36075 |
| Target Name | GLP1R |
| Gene ID | 2740, 14652, 719548, 25051, 101095495, 481778, 517420, 100065307 |
| Gene Symbol and Synonyms | Glip,GLP-1,GLP-1-R,GLP-1R,GLP1R,GLP1Rc,RATGL1RCP |
| Uniprot Accession | P43220 |
| Uniprot Entry Name | GLP1R_HUMAN |
| Protein Sub-location | Transmembrane Protein |
| Category | Therapeutics Target, INN Index |
| Disease | Not Available |
| Gene Ensembl | ENSG00000112164 |
| Target Classification | GPCR |
This gene encodes a 7-transmembrane protein that functions as a receptor for glucagon-like peptide 1 (GLP-1) hormone, which stimulates glucose-induced insulin secretion. This receptor, which functions at the cell surface, becomes internalized in response to GLP-1 and GLP-1 analogs, and it plays an important role in the signaling cascades leading to insulin secretion. It also displays neuroprotective effects in animal models. Polymorphisms in this gene are associated with diabetes. The protein is an important drug target for the treatment of type 2 diabetes and stroke. Alternative splicing of this gene results in multiple transcript variants. [provided by RefSeq, Apr 2016]
About GMVC
GMVC (GM Vector Core) is GeneMedi’s unique platform for QbD Viral vectors Processes development and manufacturing. In GMVC, our core expertise lies in the tailored production of viral vectors, including adeno-associated virus (AAV), lentivirus, and adenovirus. Our state-of-the-art facilities are equipped for scalable manufacturing, ensuring high-quality viral vector production to meet both research and therapeutic needs. Our expert team specializes in process development, leveraging innovative technology and extensive industry knowledge to provide clients with tailored solutions that exceed expectations. GMVC will be the ideal partner for scientists and healthcare professionals seeking reliable and efficient viral vector production services.
Facebook
LinkedIn
Twitter
