Human PPARA/hPPAR/ NR1C1 ORF/cDNA clone-Lentivirus plasmid (NM_005036)

Pre-made Human PPARA/hPPAR/ NR1C1 Lentiviral expression plasmid for PPARA lentivirus packaging, PPARA lentivirus production, overexpression stable cell line development, cell transient transfection and gene delivery targeting T/B/NK cells, macrophages, cardiomyocytes, hepatocytes, and neurons.

Our GM-Lentiviral vector is seamlessly integrated with the GM lentivirus packaging system. Discover more about the GM lentivirus packaging system.

Target products collectionGo to PPARA/hPPAR products collection >>
(antibodies, antigen, VLP, mRNA, ORF viral vector, etc)



Product information

Catalog No. Product Name Plasmid Grade Plasmid quantity
pGMLP003738 Human PPARA Lentivirus plasmid Research Grade 10mg, 50mg, 100mg, 500mg, >1g
GMP-like Grade 10mg, 50mg, 100mg, 500mg, >1g
High Quality (HQ) Grade
Seed 5ug


Product Description

Catalog ID pGMLP003738
Gene Name PPARA
Accession Number NM_005036
Gene ID 5465
Species Human
Product Type Lentivirus plasmid (overexpression)
Insert Length 1407 bp
Gene Alias hPPAR, NR1C1, PPAR, PPARalpha
Fluorescent Reporter ZsGreen
Mammalian Cell Selection Puromyocin
Fusion Tag 3xflag (C-Terminal)
Promoter CMV
Resistance Amplicin
Sequence ATGGTGGACACGGAAAGCCCACTCTGCCCCCTCTCCCCACTCGAGGCCGGCGATCTAGAGAGCCCGTTATCTGAAGAGTTCCTGCAAGAAATGGGAAACATCCAAGAGATTTCGCAATCCATCGGCGAGGATAGTTCTGGAAGCTTTGGCTTTACGGAATACCAGTATTTAGGAAGCTGTCCTGGCTCAGATGGCTCGGTCATCACGGACACGCTTTCACCAGCTTCGAGCCCCTCCTCGGTGACTTATCCTGTGGTCCCCGGCAGCGTGGACGAGTCTCCCAGTGGAGCATTGAACATCGAATGTAGAATCTGCGGGGACAAGGCCTCAGGCTATCATTACGGAGTCCACGCGTGTGAAGGCTGCAAGGGCTTCTTTCGGCGAACGATTCGACTCAAGCTGGTGTATGACAAGTGCGACCGCAGCTGCAAGATCCAGAAAAAGAACAGAAACAAATGCCAGTATTGTCGATTTCACAAGTGCCTTTCTGTCGGGATGTCACACAACGCGATTCGTTTTGGACGAATGCCAAGATCTGAGAAAGCAAAACTGAAAGCAGAAATTCTTACCTGTGAACATGACATAGAAGATTCTGAAACTGCAGATCTCAAATCTCTGGCCAAGAGAATCTACGAGGCCTACTTGAAGAACTTCAACATGAACAAGGTCAAAGCCCGGGTCATCCTCTCAGGAAAGGCCAGTAACAATCCACCTTTTGTCATACATGATATGGAGACACTGTGTATGGCTGAGAAGACGCTGGTGGCCAAGCTGGTGGCCAATGGCATCCAGAACAAGGAGGCGGAGGTCCGCATCTTTCACTGCTGCCAGTGCACGTCAGTGGAGACCGTCACGGAGCTCACGGAATTCGCCAAGGCCATCCCAGGCTTCGCAAACTTGGACCTGAACGATCAAGTGACATTGCTAAAATACGGAGTTTATGAGGCCATATTCGCCATGCTGTCTTCTGTGATGAACAAAGACGGGATGCTGGTAGCGTATGGAAATGGGTTTATAACTCGTGAATTCCTAAAAAGCCTAAGGAAACCGTTCTGTGATATCATGGAACCCAAGTTTGATTTTGCCATGAAGTTCAATGCACTGGAACTGGATGACAGTGATATCTCCCTTTTTGTGGCTGCTATCATTTGCTGTGGAGATCGTCCTGGCCTTCTAAACGTAGGACACATTGAAAAAATGCAGGAGGGTATTGTACATGTGCTCAGACTCCACCTGCAGAGCAACCACCCGGACGATATCTTTCTCTTCCCAAAACTTCTTCAAAAAATGGCAGACCTCCGGCAGCTGGTGACGGAGCATGCGCAGCTGGTGCAGATCATCAAGAAGACGGAGTCGGATGCTGCGCTGCACCCGCTACTGCAGGAGATCTACAGGGACATGTACTGA

Reference




    Data / case study


    Click to get more Data / Case study about the product.



    Associated products


    Category Cat No. Products Name
    Target Antibody GM-Tg-g-T86591-Ab Anti-PPARA monoclonal antibody
    Target Antigen GM-Tg-g-T86591-Ag PPARA protein
    ORF Viral Vector pGMAD000992 Human PPARA Adenovirus plasmid
    ORF Viral Vector pGMPC000211 Rat Ppara Mammalian (Non-Viral Vector) plasmid
    ORF Viral Vector pGMPC000898 Human PPARA Mammalian (Non-Viral Vector) plasmid
    ORF Viral Vector pGMLP003738 Human PPARA Lentivirus plasmid
    ORF Viral Vector vGMAD000992 Human PPARA Adenovirus particle
    ORF Viral Vector vGMLP003738 Human PPARA Lentivirus particle
    ORF Viral Vector pGMLV002200 Mouse Ppara Lentivirus plasmid


    Target information

    Target ID GM-T86591
    Target Name PPARA
    Gene ID 5465, 19013, 613250, 25747, 101095837, 403654, 281992, 100049840
    Gene Symbol and Synonyms 4933429D07Rik,hPPAR,NR1C1,PPAR,PPAR-alpha,PPARA,PPARalpha
    Uniprot Accession Q07869
    Uniprot Entry Name PPARA_HUMAN
    Protein Sub-location Introcelluar Protein
    Category Therapeutics Target
    Disease Not Available
    Gene Ensembl ENSG00000186951
    Target Classification Nuclear Receptors

    Peroxisome proliferators include hypolipidemic drugs, herbicides, leukotriene antagonists, and plasticizers; this term arises because they induce an increase in the size and number of peroxisomes. Peroxisomes are subcellular organelles found in plants and animals that contain enzymes for respiration and for cholesterol and lipid metabolism. The action of peroxisome proliferators is thought to be mediated via specific receptors, called PPARs, which belong to the steroid hormone receptor superfamily. PPARs affect the expression of target genes involved in cell proliferation, cell differentiation and in immune and inflammation responses. Three closely related subtypes (alpha, beta/delta, and gamma) have been identified. This gene encodes the subtype PPAR-alpha, which is a nuclear transcription factor. Multiple alternatively spliced transcript variants have been described for this gene, although the full-length nature of only two has been determined. [provided by RefSeq, Jul 2008]



    About GMVC

    GDU



    GMVC (GM Vector Core) is GeneMedi’s unique platform for QbD Viral vectors Processes development and manufacturing. In GMVC, our core expertise lies in the tailored production of viral vectors, including adeno-associated virus (AAV), lentivirus, and adenovirus. Our state-of-the-art facilities are equipped for scalable manufacturing, ensuring high-quality viral vector production to meet both research and therapeutic needs. Our expert team specializes in process development, leveraging innovative technology and extensive industry knowledge to provide clients with tailored solutions that exceed expectations. GMVC will be the ideal partner for scientists and healthcare professionals seeking reliable and efficient viral vector production services.