Human PPARA/hPPAR/ NR1C1 ORF/cDNA clone-Lentivirus particle (NM_005036)
Pre-made Human PPARA/hPPAR/ NR1C1 Lentiviral expression plasmid for PPARA lentivirus packaging, PPARA lentivirus production, overexpression stable cell line development, cell transient transfection and gene delivery targeting T/B/NK cells, macrophages, cardiomyocytes, hepatocytes, and neurons.
The GM Vector Core (GMVC) specializes in custom lentivirus development and offers a range of lentivirus manufacturing solutions, leveraging state-of-the-art processes. Learn more about our services.
Go
to PPARA/hPPAR products collection
>>
(antibodies,
antigen, VLP, mRNA, ORF viral vector, etc)
Product information
Catalog No. | Product Name | lentivirus Grade | lentivirus quantity |
---|---|---|---|
vGMLP003738 | Human PPARA Lentivirus particle | Pilot Grade | 1.0E+8TU |
5.0E+8TU | |||
1.0E+9TU | |||
Research Grade | 1.0E+8TU | ||
5.0E+8TU | |||
1.0E+9TU | |||
GMP-like Grade | inquiry | ||
GMP Grade | inquiry |
Product Description
Catalog ID | vGMLP003738 |
Gene Name | PPARA |
Accession Number | NM_005036 |
Gene ID | 5465 |
Species | Human |
Product Type | Lentivirus particle (overexpression) |
Insert Length | 1407 bp |
Gene Alias | hPPAR, NR1C1, PPAR, PPARalpha |
Fluorescent Reporter | ZsGreen |
Mammalian Cell Selection | Puromyocin |
Fusion Tag | 3xflag (C-Terminal) |
Promoter | CMV |
Resistance | Amplicin |
Sequence | ATGGTGGACACGGAAAGCCCACTCTGCCCCCTCTCCCCACTCGAGGCCGGCGATCTAGAGAGCCCGTTATCTGAAGAGTTCCTGCAAGAAATGGGAAACATCCAAGAGATTTCGCAATCCATCGGCGAGGATAGTTCTGGAAGCTTTGGCTTTACGGAATACCAGTATTTAGGAAGCTGTCCTGGCTCAGATGGCTCGGTCATCACGGACACGCTTTCACCAGCTTCGAGCCCCTCCTCGGTGACTTATCCTGTGGTCCCCGGCAGCGTGGACGAGTCTCCCAGTGGAGCATTGAACATCGAATGTAGAATCTGCGGGGACAAGGCCTCAGGCTATCATTACGGAGTCCACGCGTGTGAAGGCTGCAAGGGCTTCTTTCGGCGAACGATTCGACTCAAGCTGGTGTATGACAAGTGCGACCGCAGCTGCAAGATCCAGAAAAAGAACAGAAACAAATGCCAGTATTGTCGATTTCACAAGTGCCTTTCTGTCGGGATGTCACACAACGCGATTCGTTTTGGACGAATGCCAAGATCTGAGAAAGCAAAACTGAAAGCAGAAATTCTTACCTGTGAACATGACATAGAAGATTCTGAAACTGCAGATCTCAAATCTCTGGCCAAGAGAATCTACGAGGCCTACTTGAAGAACTTCAACATGAACAAGGTCAAAGCCCGGGTCATCCTCTCAGGAAAGGCCAGTAACAATCCACCTTTTGTCATACATGATATGGAGACACTGTGTATGGCTGAGAAGACGCTGGTGGCCAAGCTGGTGGCCAATGGCATCCAGAACAAGGAGGCGGAGGTCCGCATCTTTCACTGCTGCCAGTGCACGTCAGTGGAGACCGTCACGGAGCTCACGGAATTCGCCAAGGCCATCCCAGGCTTCGCAAACTTGGACCTGAACGATCAAGTGACATTGCTAAAATACGGAGTTTATGAGGCCATATTCGCCATGCTGTCTTCTGTGATGAACAAAGACGGGATGCTGGTAGCGTATGGAAATGGGTTTATAACTCGTGAATTCCTAAAAAGCCTAAGGAAACCGTTCTGTGATATCATGGAACCCAAGTTTGATTTTGCCATGAAGTTCAATGCACTGGAACTGGATGACAGTGATATCTCCCTTTTTGTGGCTGCTATCATTTGCTGTGGAGATCGTCCTGGCCTTCTAAACGTAGGACACATTGAAAAAATGCAGGAGGGTATTGTACATGTGCTCAGACTCCACCTGCAGAGCAACCACCCGGACGATATCTTTCTCTTCCCAAAACTTCTTCAAAAAATGGCAGACCTCCGGCAGCTGGTGACGGAGCATGCGCAGCTGGTGCAGATCATCAAGAAGACGGAGTCGGATGCTGCGCTGCACCCGCTACTGCAGGAGATCTACAGGGACATGTACTGA |
Reference
Data / case study
Click to get more Data / Case study about the product.
Associated products
Category | Cat No. | Products Name |
---|---|---|
Target Antibody | GM-Tg-g-T86591-Ab | Anti-PPARA monoclonal antibody |
Target Antigen | GM-Tg-g-T86591-Ag | PPARA protein |
ORF Viral Vector | pGMAD000992 | Human PPARA Adenovirus plasmid |
ORF Viral Vector | pGMPC000211 | Rat Ppara Mammalian (Non-Viral Vector) plasmid |
ORF Viral Vector | pGMPC000898 | Human PPARA Mammalian (Non-Viral Vector) plasmid |
ORF Viral Vector | pGMLP003738 | Human PPARA Lentivirus plasmid |
ORF Viral Vector | vGMAD000992 | Human PPARA Adenovirus particle |
ORF Viral Vector | vGMLP003738 | Human PPARA Lentivirus particle |
ORF Viral Vector | pGMLV002200 | Mouse Ppara Lentivirus plasmid |
Target information
Target ID | GM-T86591 |
Target Name | PPARA |
Gene ID | 5465, 19013, 613250, 25747, 101095837, 403654, 281992, 100049840 |
Gene Symbol and Synonyms | 4933429D07Rik,hPPAR,NR1C1,PPAR,PPAR-alpha,PPARA,PPARalpha |
Uniprot Accession | Q07869 |
Uniprot Entry Name | PPARA_HUMAN |
Protein Sub-location | Introcelluar Protein |
Category | Therapeutics Target |
Disease | Not Available |
Gene Ensembl | ENSG00000186951 |
Target Classification | Nuclear Receptors |
Peroxisome proliferators include hypolipidemic drugs, herbicides, leukotriene antagonists, and plasticizers; this term arises because they induce an increase in the size and number of peroxisomes. Peroxisomes are subcellular organelles found in plants and animals that contain enzymes for respiration and for cholesterol and lipid metabolism. The action of peroxisome proliferators is thought to be mediated via specific receptors, called PPARs, which belong to the steroid hormone receptor superfamily. PPARs affect the expression of target genes involved in cell proliferation, cell differentiation and in immune and inflammation responses. Three closely related subtypes (alpha, beta/delta, and gamma) have been identified. This gene encodes the subtype PPAR-alpha, which is a nuclear transcription factor. Multiple alternatively spliced transcript variants have been described for this gene, although the full-length nature of only two has been determined. [provided by RefSeq, Jul 2008]
About GMVC
GMVC (GM Vector Core) is GeneMedi’s unique platform for QbD Viral vectors Processes development and manufacturing. In GMVC, our core expertise lies in the tailored production of viral vectors, including adeno-associated virus (AAV), lentivirus, and adenovirus. Our state-of-the-art facilities are equipped for scalable manufacturing, ensuring high-quality viral vector production to meet both research and therapeutic needs. Our expert team specializes in process development, leveraging innovative technology and extensive industry knowledge to provide clients with tailored solutions that exceed expectations. GMVC will be the ideal partner for scientists and healthcare professionals seeking reliable and efficient viral vector production services.