Human DGAT1/ARAT/ ARGP1 ORF/cDNA clone-Lentivirus plasmid (NM_012079)

Pre-made Human DGAT1/ARAT/ ARGP1 Lentiviral expression plasmid for DGAT1 lentivirus packaging, DGAT1 lentivirus production, overexpression stable cell line development, cell transient transfection and gene delivery targeting T/B/NK cells, macrophages, cardiomyocytes, hepatocytes, and neurons.

Our GM-Lentiviral vector is seamlessly integrated with the GM lentivirus packaging system. Discover more about the GM lentivirus packaging system.

Target products collectionGo to DGAT1/ARAT products collection >>
(antibodies, antigen, VLP, mRNA, ORF viral vector, etc)



Product information

Catalog No. Product Name Plasmid Grade Plasmid quantity
pGMLP003759 Human DGAT1 Lentivirus plasmid Research Grade 10mg, 50mg, 100mg, 500mg, >1g
GMP-like Grade 10mg, 50mg, 100mg, 500mg, >1g
High Quality (HQ) Grade
Seed 5ug


Product Description

Catalog ID pGMLP003759
Gene Name DGAT1
Accession Number NM_012079
Gene ID 8694
Species Human
Product Type Lentivirus plasmid (overexpression)
Insert Length 1467 bp
Gene Alias ARAT, ARGP1, DGAT, DIAR7
Fluorescent Reporter ZsGreen
Mammalian Cell Selection Puromyocin
Fusion Tag 3xflag (C-Terminal)
Promoter CMV
Resistance Amplicin
Sequence ATGGGCGACCGCGGCAGCTCCCGGCGCCGGAGGACAGGGTCGCGGCCCTCGAGCCACGGCGGCGGCGGGCCTGCGGCGGCGGAAGAGGAGGTGCGGGACGCCGCTGCGGGCCCCGACGTGGGAGCCGCGGGGGACGCGCCAGCCCCGGCCCCCAACAAGGACGGAGACGCCGGCGTGGGCAGCGGCCACTGGGAGCTGAGGTGCCATCGCCTGCAGGATTCTTTATTCAGCTCTGACAGTGGCTTCAGCAACTACCGTGGCATCCTGAACTGGTGTGTGGTGATGCTGATCTTGAGCAATGCCCGGTTATTTCTGGAGAACCTCATCAAGTATGGCATCCTGGTGGACCCCATCCAGGTGGTTTCTCTGTTCCTGAAGGATCCCTATAGCTGGCCCGCCCCATGCCTGGTTATTGCGGCCAATGTCTTTGCTGTGGCTGCATTCCAGGTTGAGAAGCGCCTGGCGGTGGGTGCCCTGACGGAGCAGGCGGGACTGCTGCTGCACGTGGCCAACCTGGCCACCATTCTGTGTTTCCCAGCGGCTGTGGTCTTACTGGTTGAGTCTATCACTCCAGTGGGCTCCCTGCTGGCGCTGATGGCGCACACCATCCTCTTCCTCAAGCTCTTCTCCTACCGCGACGTCAACTCATGGTGCCGCAGGGCCAGGGCCAAGGCTGCCTCTGCAGGGAAGAAGGCCAGCAGTGCTGCTGCCCCGCACACCGTGAGCTACCCGGACAATCTGACCTACCGCGATCTCTACTACTTCCTCTTCGCCCCCACCTTGTGCTACGAGCTCAACTTTCCCCGCTCTCCCCGCATCCGGAAGCGCTTTCTGCTGCGACGGATCCTTGAGATGCTGTTCTTCACCCAGCTCCAGGTGGGGCTGATCCAGCAGTGGATGGTCCCCACCATCCAGAACTCCATGAAGCCCTTCAAGGACATGGACTACTCACGCATCATCGAGCGCCTCCTGAAGCTGGCGGTCCCCAATCACCTCATCTGGCTCATCTTCTTCTACTGGCTCTTCCACTCCTGCCTGAATGCCGTGGCTGAGCTCATGCAGTTTGGAGACCGGGAGTTCTACCGGGACTGGTGGAACTCCGAGTCTGTCACCTACTTCTGGCAGAACTGGAACATCCCTGTGCACAAGTGGTGCATCAGACACTTCTACAAGCCCATGCTTCGACGGGGCAGCAGCAAGTGGATGGCCAGGACAGGGGTGTTCCTGGCCTCGGCCTTCTTCCACGAGTACCTGGTGAGCGTCCCTCTGCGAATGTTCCGCCTCTGGGCGTTCACGGGCATGATGGCTCAGATCCCACTGGCCTGGTTCGTGGGCCGCTTTTTCCAGGGCAACTATGGCAACGCAGCTGTGTGGCTGTCGCTCATCATCGGACAGCCAATAGCCGTCCTCATGTACGTCCACGACTACTACGTGCTCAACTATGAGGCCCCAGCGGCAGAGGCCTGA

Reference




    Data / case study


    Click to get more Data / Case study about the product.



    Associated products


    Category Cat No. Products Name
    Target Antibody GM-Tg-g-T16688-Ab Anti-DGAT1/ ARAT/ ARGP1 monoclonal antibody
    Target Antigen GM-Tg-g-T16688-Ag DGAT1 VLP (virus-like particle)
    ORF Viral Vector pGMLP003759 Human DGAT1 Lentivirus plasmid
    ORF Viral Vector vGMLP003759 Human DGAT1 Lentivirus particle


    Target information

    Target ID GM-T16688
    Target Name DGAT1
    Gene ID 8694, 13350, 701489, 84497, 101101615, 482093, 282609, 100147359
    Gene Symbol and Synonyms ARAT,ARGP1,D15Ertd23e,DGAT,DGAT1,DIAR7
    Uniprot Accession O75907
    Uniprot Entry Name DGAT1_HUMAN
    Protein Sub-location Transmembrane Protein
    Category Therapeutics Target
    Disease Not Available
    Gene Ensembl ENSG00000185000
    Target Classification Not Available

    This gene encodes an multipass transmembrane protein that functions as a key metabolic enzyme. The encoded protein catalyzes the conversion of diacylglycerol and fatty acyl CoA to triacylglycerol. This enzyme can also transfer acyl CoA to retinol. Activity of this protein may be associated with obesity and other metabolic diseases. [provided by RefSeq, Jul 2013]



    About GMVC

    GDU



    GMVC (GM Vector Core) is GeneMedi’s unique platform for QbD Viral vectors Processes development and manufacturing. In GMVC, our core expertise lies in the tailored production of viral vectors, including adeno-associated virus (AAV), lentivirus, and adenovirus. Our state-of-the-art facilities are equipped for scalable manufacturing, ensuring high-quality viral vector production to meet both research and therapeutic needs. Our expert team specializes in process development, leveraging innovative technology and extensive industry knowledge to provide clients with tailored solutions that exceed expectations. GMVC will be the ideal partner for scientists and healthcare professionals seeking reliable and efficient viral vector production services.