Human SFTPB/PSP-B/ SFTB3 ORF/cDNA clone-Lentivirus plasmid (NM_198843)
Pre-made Human SFTPB/PSP-B/ SFTB3 Lentiviral expression plasmid for SFTPB lentivirus packaging, SFTPB lentivirus production, overexpression stable cell line development, cell transient transfection and gene delivery targeting T/B/NK cells, macrophages, cardiomyocytes, hepatocytes, and neurons.
Our GM-Lentiviral vector is seamlessly integrated with the GM lentivirus packaging system. Discover more about the GM lentivirus packaging system.
Go
to SFTPB/PSP-B products collection
>>
(antibodies,
antigen, VLP, mRNA, ORF viral vector, etc)
Product information
Catalog No. | Product Name | Plasmid Grade | Plasmid quantity |
---|---|---|---|
pGMLP003815 | Human SFTPB Lentivirus plasmid | Research Grade | 10mg, 50mg, 100mg, 500mg, >1g |
GMP-like Grade | 10mg, 50mg, 100mg, 500mg, >1g | ||
High Quality (HQ) Grade | |||
Seed | 5ug |
Product Description
Catalog ID | pGMLP003815 |
Gene Name | SFTPB |
Accession Number | NM_198843 |
Gene ID | 6439 |
Species | Human |
Product Type | Lentivirus plasmid (overexpression) |
Insert Length | 1182 bp |
Gene Alias | PSP-B, SFTB3, SFTP3, SMDP1, SP-B |
Fluorescent Reporter | ZsGreen |
Mammalian Cell Selection | Puromyocin |
Fusion Tag | 3xflag (C-Terminal) |
Promoter | CMV |
Resistance | Amplicin |
Sequence | ATGCACCAAGCAGGGTACCCAGGCTGCAGAGGTGCCATGGCTGAGTCACACCTGCTGCAGTGGCTGCTGCTGCTGCTGCCCACGCTCTGTGGCCCAGGCACTGCTGCCTGGACCACCTCATCCTTGGCCTGTGCCCAGGGCCCTGAGTTCTGGTGCCAAAGCCTGGAGCAAGCATTGCAGTGCAGAGCCCTAGGGCATTGCCTACAGGAAGTCTGGGGACATGTGGGAGCCGATGACCTATGCCAAGAGTGTGAGGACATCGTCCACATCCTTAACAAGATGGCCAAGGAGGCCATTTTCCAGGACACGATGAGGAAGTTCCTGGAGCAGGAGTGCAACGTCCTCCCCTTGAAGCTGCTCATGCCCCAGTGCAACCAAGTGCTTGACGACTACTTCCCCCTGGTCATCGACTACTTCCAGAACCAGACTGACTCAAACGGCATCTGTATGCACCTGGGCCTGTGCAAATCCCGGCAGCCAGAGCCAGAGCAGGAGCCAGGGATGTCAGACCCCCTGCCCAAACCTCTGCGGGACCCTCTGCCAGACCCTCTGCTGGACAAGCTCGTCCTCCCTGTGCTGCCCGGGGCCCTCCAGGCGAGGCCTGGGCCTCACACACAGGATCTCTCCGAGCAGCAATTCCCCATTCCTCTCCCCTATTGCTGGCTCTGCAGGGCTCTGATCAAGCGGATCCAAGCCATGATTCCCAAGGGTGCGCTAGCTGTGGCAGTGGCCCAGGTGTGCCGCGTGGTACCTCTGGTGGCGGGCGGCATCTGCCAGTGCCTGGCTGAGCGCTACTCCGTCATCCTGCTCGACACGCTGCTGGGCCGCATGCTGCCCCAGCTGGTCTGCCGCCTCGTCCTCCGGTGCTCCATGGATGACAGCGCTGGCCCAAGGTCGCCGACAGGAGAATGGCTGCCGCGAGACTCTGAGTGCCACCTCTGCATGTCCGTGACCACCCAGGCCGGGAACAGCAGCGAGCAGGCCATACCACAGGCAATGCTCCAGGCCTGTGTTGGCTCCTGGCTGGACAGGGAAAAGTGCAAGCAATTTGTGGAGCAGCACACGCCCCAGCTGCTGACCCTGGTGCCCAGGGGCTGGGATGCCCACACCACCTGCCAGGCCCTCGGGGTGTGTGGGACCATGTCCAGCCCTCTCCAGTGTATCCACAGCCCCGACCTTTGA |
Reference
Data / case study
Click to get more Data / Case study about the product.
Associated products
Category | Cat No. | Products Name |
---|---|---|
Target Antibody | GM-Tg-g-SE1289-Ab | Anti-PSPB/ SFTPB/ PSP-B functional antibody |
Target Antigen | GM-Tg-g-SE1289-Ag | SFTPB protein |
ORF Viral Vector | pGMLP003815 | Human SFTPB Lentivirus plasmid |
ORF Viral Vector | pGMAP000392 | Human SFTPB Adenovirus plasmid |
ORF Viral Vector | vGMLP003815 | Human SFTPB Lentivirus particle |
ORF Viral Vector | vGMAP000392 | Human SFTPB Adenovirus particle |
Target information
Target ID | GM-SE1289 |
Target Name | SFTPB |
Gene ID | 6439, 20388, 696477, 192155, 101091359, 100688334, 507398, 100034028 |
Gene Symbol and Synonyms | PSP-B,SF-B,SFTB3,Sftp-3,SFTP3,SFTPB,SMDP1,SP-B |
Uniprot Accession | P07988 |
Uniprot Entry Name | PSPB_HUMAN |
Protein Sub-location | Secreted Protein/Potential Cytokines |
Category | Not Available |
Disease | Lung Cancer |
Gene Ensembl | ENSG00000168878 |
Target Classification | Not Available |
This gene encodes the pulmonary-associated surfactant protein B (SPB), an amphipathic surfactant protein essential for lung function and homeostasis after birth. Pulmonary surfactant is a surface-active lipoprotein complex composed of 90% lipids and 10% proteins which include plasma proteins and apolipoproteins SPA, SPB, SPC and SPD. The surfactant is secreted by the alveolar cells of the lung and maintains the stability of pulmonary tissue by reducing the surface tension of fluids that coat the lung. The SPB enhances the rate of spreading and increases the stability of surfactant monolayers in vitro. Multiple mutations in this gene have been identified, which cause pulmonary surfactant metabolism dysfunction type 1, also called pulmonary alveolar proteinosis due to surfactant protein B deficiency, and are associated with fatal respiratory distress in the neonatal period. Alternatively spliced transcript variants encoding the same protein have been identified.[provided by RefSeq, Feb 2010]
About GMVC
GMVC (GM Vector Core) is GeneMedi’s unique platform for QbD Viral vectors Processes development and manufacturing. In GMVC, our core expertise lies in the tailored production of viral vectors, including adeno-associated virus (AAV), lentivirus, and adenovirus. Our state-of-the-art facilities are equipped for scalable manufacturing, ensuring high-quality viral vector production to meet both research and therapeutic needs. Our expert team specializes in process development, leveraging innovative technology and extensive industry knowledge to provide clients with tailored solutions that exceed expectations. GMVC will be the ideal partner for scientists and healthcare professionals seeking reliable and efficient viral vector production services.