Human SFTPB/PSP-B/ SFTB3 ORF/cDNA clone-Adenovirus particle (BC032785)

Pre-made Human SFTPB/PSP-B/ SFTB3 Adenovirus for SFTPB overexpression in-vitro and in-vivo. The SFTPB adenoviral vector excels as a vehicle for transient gene transfection in both stable cell lines and primary cells, including DC cells, macrophages, cardiomyocytes, hepatocytes, and neurons. The purified SFTPB-encoding adenovirus also stands out as a quintessential tool for in vivo studies and vaccine research initiatives.

At GM Vector Core (GMVC), we provide bespoke adenovirus development and manufacture various grades of adenoviruses utilizing cutting-edge techniques. Dive deeper into our offerings.

Target products collectionGo to SFTPB/PSP-B products collection >>
(antibodies, antigen, VLP, mRNA, ORF viral vector, etc)



Product information

Catalog No. Product Name Adenovirus Grade Adenovirus quantity
vGMAP000392 Human SFTPB Adenovirus particle Research Grade-In vitro 1E+10PFU (1E+10pfu/ml×1ml)
5E+10PFU (1E+10pfu/ml×5ml)
1E+11PFU (1E+10pfu/ml×10ml)
Research Grade-In vivo 1E+11PFU (1E+11pfu/ml×1ml)
GMP-like Grade inquiry
GMP Grade inquiry


Product Description

Catalog ID vGMAP000392
Gene Name SFTPB
Accession Number BC032785
Gene ID 6439
Species Human
Product Type Adenovirus particle (overexpression)
Insert Length 1146 bp
Gene Alias PSP-B, SFTB3, SMDP1, SP-B
Fluorescent Reporter ZsGreen
Mammalian Cell Selection Puromyocin
Fusion Tag 3xflag (C-Terminal)
Promoter CMV
Resistance Amplicin
Sequence ATGGCTGAGTCACACCTGCTGCAGTGGCTGCTGCTGCTGCTGCCCACGCTCTGTGGCCCAGGCACTGCTGCCTGGACCACCTCATCCTTGGCCTGTGCCCAGGGCCCTGAGTTCTGGTGCCAAAGCCTGGAGCAAGCATTGCAGTGCAGAGCCCTAGGGCATTGCCTACAGGAAGTCTGGGGACATGTGGGAGCCGATGACCTATGCCAAGAGTGTGAGGACATCGTCCACATCCTTAACAAGATGGCCAAGGAGGCCATTTTCCAGGACACGATGAGGAAGTTCCTGGAGCAGGAGTGCAACGTCCTCCCCTTGAAGCTGCTCATGCCCCAGTGCAACCAAGTGCTTGACGACTACTTCCCCCTGGTCATCGACTACTTCCAGAACCAGACTGACTCAAACGGCATCTGTATGCACCTGGGCCTGTGCAAATCCCGGCAGCCAGAGCCAGAGCAGGAGCCAGGGATGTCAGACCCCCTGCCCAAACCTCTGCGGGACCCTCTGCCAGACCCTCTGCTGGACAAGCTCGTCCTCCCTGTGCTGCCCGGGGCCCTCCAGGCGAGGCCTGGGCCTCACACACAGGATCTCTCCGAGCAGCAATTCCCCATTCCTCTCCCCTATTGCTGGCTCTGCAGGGCTCTGATCAAGCGGATCCAAGCCATGATTCCCAAGGGTGCGCTAGCTGTGGCAGTGGCCCAGGTGTGCCGCGTGGTACCTCTGGTGGCGGGCGGCATCTGCCAGTGCCTGGCTGAGCGCTACTCCGTCATCCTGCTCGACACGCTGCTGGGCCGCATGCTGCCCCAGCTGGTCTGCCGCCTCGTCCTCCGGTGCTCCATGGATGACAGCGCTGGCCCAAGGTCGCCGACAGGAGAATGGCTGCCGCGAGACTCTGAGTGCCACCTCTGCATGTCCGTGACCACCCAGGCCGGGAACAGCAGCGAGCAGGCCATACCACAGGCAATGCTCCAGGCCTGTGTTGGCTCCTGGCTGGACAGGGAAAAGTGCAAGCAATTTGTGGAGCAGCACACGCCCCAGCTGCTGACCCTGGTGCCCAGGGGCTGGGATGCCCACACCACCTGCCAGGCCCTCGGGGTGTGTGGGACCATGTCCAGCCCTCTCCAGTGTATCCACAGCCCCGACCTTTGA

Reference




    Data / case study


    Click to get more Data / Case study about the product.



    Associated products


    Category Cat No. Products Name
    Target Antibody GM-Tg-g-SE1289-Ab Anti-PSPB/ SFTPB/ PSP-B functional antibody
    Target Antigen GM-Tg-g-SE1289-Ag SFTPB protein
    ORF Viral Vector pGMLP003815 Human SFTPB Lentivirus plasmid
    ORF Viral Vector pGMAP000392 Human SFTPB Adenovirus plasmid
    ORF Viral Vector vGMLP003815 Human SFTPB Lentivirus particle
    ORF Viral Vector vGMAP000392 Human SFTPB Adenovirus particle


    Target information

    Target ID GM-SE1289
    Target Name SFTPB
    Gene ID 6439, 20388, 696477, 192155, 101091359, 100688334, 507398, 100034028
    Gene Symbol and Synonyms PSP-B,SF-B,SFTB3,Sftp-3,SFTP3,SFTPB,SMDP1,SP-B
    Uniprot Accession P07988
    Uniprot Entry Name PSPB_HUMAN
    Protein Sub-location Secreted Protein/Potential Cytokines
    Category Not Available
    Disease Lung Cancer
    Gene Ensembl ENSG00000168878
    Target Classification Not Available

    This gene encodes the pulmonary-associated surfactant protein B (SPB), an amphipathic surfactant protein essential for lung function and homeostasis after birth. Pulmonary surfactant is a surface-active lipoprotein complex composed of 90% lipids and 10% proteins which include plasma proteins and apolipoproteins SPA, SPB, SPC and SPD. The surfactant is secreted by the alveolar cells of the lung and maintains the stability of pulmonary tissue by reducing the surface tension of fluids that coat the lung. The SPB enhances the rate of spreading and increases the stability of surfactant monolayers in vitro. Multiple mutations in this gene have been identified, which cause pulmonary surfactant metabolism dysfunction type 1, also called pulmonary alveolar proteinosis due to surfactant protein B deficiency, and are associated with fatal respiratory distress in the neonatal period. Alternatively spliced transcript variants encoding the same protein have been identified.[provided by RefSeq, Feb 2010]



    About GMVC

    GDU



    GMVC (GM Vector Core) is GeneMedi’s unique platform for QbD Viral vectors Processes development and manufacturing. In GMVC, our core expertise lies in the tailored production of viral vectors, including adeno-associated virus (AAV), lentivirus, and adenovirus. Our state-of-the-art facilities are equipped for scalable manufacturing, ensuring high-quality viral vector production to meet both research and therapeutic needs. Our expert team specializes in process development, leveraging innovative technology and extensive industry knowledge to provide clients with tailored solutions that exceed expectations. GMVC will be the ideal partner for scientists and healthcare professionals seeking reliable and efficient viral vector production services.